Comments about this list: This data describes most commercially available type II restriction enzymes and certain intron and intein encoded endonucleases. The table under each enzyme shows their source, followed by a designation in parentheses for that manufacturers' recommended buffer, i.e. "BRL(2)" = React 2 buffer from Bethesda Research Laboratories. Buffer components are given in millimolar units. Numbers in the "Tris-HCl" column show the tris-HCl concentration and pH (in parentheses). The pH of tris buffered solutions decreases approximately 0.3 pH units per 10°C increase in temperature and is markedly affected by dilution (i.e. the pH of tris-buffered working solutions may not be the same as their concentrated stocks).

Abbreviations: mM, millimolar; me, methylated; BAP, bacterial alkaline phosphatase; ssDNA/dsDNA, single or double stranded DNA; triton, triton X-100; nt, nucleotide(s).

The author gratefully acknowledges the information provided by the following companies in their catalogs: Amer, Amersham Pharmacia (formerly US Biochemicals); BRL, Bethesda Research Laboratories, Inc.; NEB, New England Biolabs, Inc.; Ph, Pharmacia, also Amersham Pharmacia (bought P-L Biochemicals); Pro, Promega Corp; Roche, Roche Molecular Biochemicals (merged with Boehringer Mannheim Biochemicals); Tak, Takara Shuzo Co., Ltd. The data contained in this file is meant only to serve as an aid for experimental design and interpretation. The author does not assume responsibility for the accuracy of the information provided herein, nor for the failure of experiments that may result from the use of this inf ormation. Readers are encouraged to submit comments that may be useful for future, updated versions of this database.

Last updated July 2000.
Bart Frank

Proper citation for data acquired from this document is: "Frank, M. B. Restriction Enzyme Database. In: Frank, M. B. ed. Molecular Biology Protocols. (http://www.omrf.org/OMRF/Research/09/FrankLab/homerestenz.html). 1997. Oklahoma City. Revision Date: July 21, 2000."




Aat II
GACGT'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- ------- -- 0.5 (1)
NEB(4) -- -- -- 1 (2)
Ph(KM)   10(7.5) 10 1 (3)
Pro(J) -- 10(7.5) 7 1 (3)
Roche(A) -- --------- - (1)
Tak(T) -- ------- -- 0.5 (4)
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: None.
Inactivation Temp: 65°C, 15 min (Pro), 20 min (Amer, NEB), 70°C 15 min (residual activity after 15 min @ 65 &176;C (Tak); 85°C, 30 min (Ph).
Notes: Use 5-10x less enzyme for pBR322 than lambda. Stable 18 mo (Roche). Optimal pH between pH 7.5 - 8.0 at 25°C (NEB). Activity increases 5x with KCl vs NaCl (NEB). Cuts in PC R buffer (Pro). <10% activity in Pro(H) buffer (Pro). Star activity in presence of DMSO (Tak). No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5me-C (Ph, NEB), and 3' 5me-C (Tak).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 50 mM K-acetate, 20 mM Tris-acetate (7.9), 10 mM Mg-acetate.
(3): 50 mM KCl.
(4): 33 mM tris-acetate, pH 7.9; 10 mM magnesium acetate; 66 mM potassium acetate; 0.01% BSA.


Acc I
GT'(AC)(TG)AC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(1) -- 50(8.0) 10 -  
NEB(4) -- --------- 1 (2)
Ph(L) -- 10(7.5) 10 1  
Pro(G) -- 50(8.2) 5 -  
Roche(A) -- ------- -- 0.5 (1)
Tak(M) 50 10(7.5) 10 1  
Digest temp: 37°C; 5x more active at 55° vs 37° (BRL).
Isoschizomers: None.
Other Compatible Ends: Aci I, Acy I, Aha II, Ban III, Bbi II, BsaH I, BsiX I, Bsp106 I, BspD I, BstB I, Cla I, Csp45 I, HinP I, Hap II, Hpa II, HgiD I, Hin1 I, HinP1 I, Mae II, Msp I, Nar I, Nsp V, Nsp7524 I, Psp1406 I, Sal I, Sfu I, Taq I, Xma I.
Inactivation Temp: 65°C, 20 min (NEB); 70°C, 15 min (Amer, Tak); 85°C, 30 min (Ph), not inactivated at 65°C, 15 min (Pro), 10 min (BRL).
Notes: Single site in M13 & pUC polylinkers. Inhibited by or star activity noted with >100 mM NaCl. Use 4 U/µg pBR322 (BRL). Still active after 5 hr (BRL). 5x more active at 55° vs 37° (BRL). Does not cut in PCR buffer (Roche). <10% activity in Pro(H) buffer (Pro). No activity after ethanol precipitation (Tak). Does not cut olignucleotides with up to 3 bt on each side of the Acc I site (NEB). Atleast 1/3 of the ends are able to religate (BRL).
Methylation Effects: No cuts if 3'me-A or 3' 5me-C (BRL, Ph, Tak), or 5' 5me-C (Tak).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


AccII
CG'CG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
Tak(M) 50 10 (7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Bsh1236 I, BstU I, Mvn I, Tha I, FnuDII.
Inactivation Temp: Not heat inactivated, use ethanol precipitation (Amer, Tak).
Notes: No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5' 5me-C (Tak).


Acc III
T'CCGGA
< !-- Table 04 Row 01 -->
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(F) 100 10(8.5) 10 1  
Tak(Basal) -- ------- -- --  
Digest Temp: 65°C.
Isoschizomers: BseA I, BsiM I, Bsp13 I, BspE I, BspE II, BspMII, Kpn2 I, Mro I.
Other Compatible Ends: Bca77I, BspEI, Cfr9I, MroI, XmaI.
Inactivation Temp: Not inactivated at 65°C (Pro); use ethanol precipitation (Amer); 70°C 15 min (Tak).
Notes: 10-25% activity at 37°C (Pro). Not active after ethanol precipitation (Tak).
Methylation Effects: Sensitive to dam methylation (Pro, Tak); cuts if 5me-C (Tak).


Acc65 I
G'GTACC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 (1)
Pro(D) 150 6(7.9) 6 1  
Digest Temp: 37°C.
Inactivation Temp: 65°C, 15 min (Pro), 20 min (NEB).
Isoschizomers: Kpn I (Pro: has star act unlike Acc65 I), Asp718 I.
Other Compatible Ends: Asp718 I, Kpn I, Spl I.
Notes: No star activity (Pro) & lower exonuclease activity than with KpnI. Activity determined with Ad-2 DNA (Pro). Only 50% of religated fragments form Acc65 I sites, others are HpaII/MspI sites (NEB). After digest, fill-in, and ligation, site can be cut with BsaA I, Mae II, Rsa I, or SnaB I (NEB). Sensitive to overlapping dcm methylation unlike KpnI (NEB). 100% activity in Pro(H) buffer (Pro).
Methylation Effects: dcm sensitive; KpnI is not dcm sensitive (NEB). No cuts if if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 1 µg/ml BSA.


AccB7 I
CCAN4'NTGG
< B>Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(E) 100 6(7.5) 6 1  
Digest Temp: 37°C.
Isoschizomers: PflM I (not dcm methylation sensitive), Esp1396 I, Van9 I.
Notes: Star activity with low [salt], high pH, or Pro(C) buffer (Pro).
Methylati on Effects: Sensitive to overlapping dcm methylation (Pro).


Aci I
C'CGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Non-palindromic site. After ligation, but 50% of molecules have Aci I site (NEB). After digest, fill-in, and ligation, site can be cut with Aci I, BstU I, or Hha I (NEB).
Methylation Effects: No cuts if if meC-G (NEB).


Acl I
AA'CGTT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Isoschizomers:Psp1406 I.
Other Compatible Ends: Aci I, Acy I, Aha II, Asu II, Ban III, Bbi II, BsaH I, BsiC I, BsiX I, Bsp106 I, BspD I, BstB I, Cla I, Csp45 I, Fnu4H I, Hap II, HgiD I, Hin1 I, HinP I, HinP1 I, Hpa II, Hsp92 I, Mae II, M lu I, Msp I, Nar I, Nsp V, Nsp7524 V, Nun II, Psp1406 I, Sfu I; some Acc I sites.
Digest Temp: 37°C.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1):20 mM tris-acetate(7.9), 10 mM Mg-acetate, 50 mM K-acetate, 0.1% BSA.


Acs I
(A,G)'AATT(T,C)
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 -- (1)
Digest Temp: 50°C (Roche).
Isoschizmers: Psp1406 I
Inactivation Temp:Not inactivated at 65°C, 20 min (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1) : 1 mM 2-mercaptoethanol.


Acy I
GPu'CGPyC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 - (1)
Digest Temp: 50°C (Roche); only 4 0% active at 37°C (Amer).
Isoschizomers: Bbi II, BsaH I, BsaH II, Hin1 I, Hsp92 I, Msp17 I.
Other Compatible Ends: AhaII, AsuII, Ban III, Bbi II, BstBI, ClaI, Csp45I, HapII, Hin1I, HinPI, HpaII, MaeII, MspI, NarI, NspV, SfuI, TaqI, TthHB8I.
Inactivation Temp: 70°C, 5 min (Amer); 65°C, 15 min (Pro).
Notes: Replaced with Hsp92 I by Pro in 1997 catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1 ): 1 mM 2-ME.


Afa I
GT'AC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Tak(T) -- ------- -- 0.5 (1)
Digest Temp: 37°C.
Isoschizomers: Rsa I.
Other Compatible Ends: Blunt.
Inactivation Temp: 70°C, 15 min; still active after 15 min @ 65°C (Tak).
Notes: Residual activity remains after ethanol precipitation (Tak).
Methylation Effects: Cuts hemi-methylated mC, but not bi-methylated (Tak).
Other Buffer Components:
(1): 33 mM tris-acetate, pH 7.9; 10 mM magnesium acetate; 66 mM potassium acetate; 0.01% BSA.


Afe I
AGC'GCT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(-) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Aor51H I, Eco47 I.
Inactivation Temp: 65°C, 20 min (NE B).
Notes: >80% of the fragments can be ligated (NEB).
Methylation Effects: Unknown
Other Buffer Components:
Notes: Sold by NEB from SibEnzyme. (1): 66 mM K-acetate; 33 mM Tris-acetate (7.9); 10 mM Mg-acetate (Sib enzyme buffer SE5-Y).


Afl II
C'TTAAG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1 (1)
BRL(1) -- 50(8.0) 10 -  
NEB(2) 50 10(7.9) 10 1 (1)
Tak(M) 50 10(7.5) 10 1 (2)
Digest Temp: 37°C.
Isoschizomers: Bfr I, BspT I, Bst98 I, MspC I, Vha464 I.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 20 min (NEB); Partial activity after 10 min at 65°C (BRL).
Notes: About 50% of AflII ends can be religated; helped with high [ligase] (NEB). 80% activity in Tak(M). Decreased activity after 1 hr. After digest, fill-in, and ligatio n, site can be cut with Mse I, Pac I, or Tsp509 I (NEB). No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5me-C (Tak) or 3' N6-me-A (Tak).
Other Buffer Components:
(1): 0.1% BSA.
(2): 0.01% BSA

Afl III
A'C(A/G)(C/T)GT
Source [NaCl] [Tris](pH) [Mg++] [ DTT] Other
BRL(3) 100 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1 (1)
Roche(H) 100 50(7.5) 10 -- (2)
Digest Temp: 37°C.
Inactivation Temp: Not inactivated 65°C, 10 m in (BRL), 20 min (Amer, NEB); Inactivated 80#176;C, 20 min (NEB).
Notes: 1 site in pBR322 & pUC. Decreased activity after 1 hr. Sequence can contain ATG start codon. Need at least 2 nt on each side of the AflIII site for oligonucleotid digestion (NEB). Remove fom 2000 Amer catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1) 0.1% BSA.
(2) 1 mM DTE.


Age I
A'CCGGT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(1) -- ------- -- 1 (1)
Pro(K) -- 10(7.4) 10 - (2)
Digest Temp: 25°C (NEB), 37& #176;C (Pro).
Isoschizomers: PinA I.
Other Compatible Ends: Ava I, BsaW I, BspE I, BsrF I, NgoM I, Xma II.
Inactivation Temp: 65°C, 15 min (Pro), 20 min (NEB).
Notes: After digest, fill-in, and ligation, site can be cut with BsiE I, BsrF I, Eae I, Eag I, Hae III, or Hpa II (NEB). Fully active at 25°C (Pro).
Methylation Effects: No cuts if if meC-G (NEB).
Other Buffer Components:
(1): 10 mM bis tris propane-HCl (7. 0), 10 mM MgCl2.
(2) 150 mM KCl.


Ahd I
GACNNN'NNGTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.< BR> Isoschizomers: AspE I, Eam1105 I, EclHK I.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: About 25% of AhdI ends can be religated (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1):20 mM tris-acetate(7.9), 10 mM Mg-acetate, 50 mM K-acetate, 0.1% BSA.


Alu I
AG'CT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
BRL(1) -- 50(8.0) 10 -  
NEB(2) 50 10(7.9) 10 1  < /TD>
Ph(L) -- 10(7.5) 10 1  
Pro(B) 50 6(7.6) 6 1  
Roche(A) -- ------- -- 0.5 (1)
Tak(L) -- 10(7.5) 10 1 &nb sp;
Digest Temp: 37°C.
Isoschizomers: Oxa I.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB, Ph).
Notes: No cuts of me-C or me-A (Ph). Cuts at SstI & HindIII sites. Activity varies with substrate. Moderately BAP resistant. Stable 18 mo (Roche). Cuts DNA & perhaps RNA of DNA/RNA hybrids. Correlation between # sites and amount of enzyme needed. Still active after 5 hours. Residual activity after ethanol precipitation (Tak). Cuts in PCR buffer (Pro, Roche).
Methylation Effects: No cuts if N6-me-A, 5me-C (BRL, Tak), or 4me-C (Tak).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C. Use Roche(B) buffer for low enzyme concentration, Roche(A) for high concentration. Methylase available.


Alw I
5'-GGATC(N)4'- 3'//3'-CCTAG(N)-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: AclW I.
Inactivation Temp: 65°C, 10 min (BRL); 2 0 min (NEB, Amer).
Notes: 25-50% of these fragments can be religated; 1 bp extension, use high [ligase] (NEB). Use >8U/µg pBR322.
Methylation Effects: Blocked by dam methylation (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


Alw26 I
GTCTCN'//CAGAGN5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(C) 50 10(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: BsmA I.
Inactivation Temp: 65°C, 15 min (Pro), 20 min (NEB).
Notes: Star activity with 25U/µg 16 hrs (NEB).
Methylation Effects: No c uts if if meC-G (NEB).
Other Buffer Components:
(1): 66 mM K-acetate, 33 mM Tris-acetate (7.9), 10 mM Mg-acetate, 0.1% BSA.


Alw44 I
G'TGCAC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(C) 50 1 0(7.9) 10 1  
Roche(A) -- ------- -- 0.5 (1)
Digest Temp: 37°C.
Isoschizomers: ApaL I, Sno I, Vne I.
Inactivation Temp: 70°C, 5 min (Amer); 65°C, 15 min (Pro).
Notes: Active >5 hrs (BRL).
Methylation Effects: Unknown
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.


AlwN I
CAGNNN'CTG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(2) 50 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C 10 min (BRL), 20 min (Amer, NEB).
Notes: Removed from 2000 Amer catalog.
Methylation Effects: Blocked by dcm (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): 33 mM Tris-acetate (7.9); 10 mM Mg-acetat e; 66 mM K-acetate.


Aoc I
CC'TNAGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Other Comp atible Ends: Axy I, Bse21 I, Bsu36 I, Cvn I, Dde I, Eco81 I, Sau I.
Inactivation Temp: Not inactivated at 65°C, 15 min (Roche).
Notes: Replaced Sau I (Roche).
Methylation Effects: Unknown


Aor51H I
AGC'GCT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Afe I, Eco47 III.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C, 15 min (Amer, Tak).
Notes: No activity after eth anol precipitation (Tak).
Methylation Effects: No cuts if 5' 5me-C (Tak).


Apa I
GGGCC'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
BRL(4) -- 20(7.4) 5 - (2)
NEB(4) -- ------- -- 1 (3)
Ph(L) -- 10(7.5) 10 1  
Pro(A) 6 6(7.5) 6 1  
Roche(A) -- ------- -- 0.5 (1)
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 25°C (NEB), 30°C (Roche), 37°C (Amer, Ph, Pro). Optimal temperature is 30-32°C; 33% loss of activity at 37°C (BRL).
Isoschizomers: Bsp120 I (different cut site), PspOM I (different cut site).
Other Compatible Ends: None.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB, Ph).
Notes: Rare site. Inhibited by >50 mM (NEB) or >100 mM NaCl (Amer). 50% loss of activity if NaCl is substituted for KCl (BRL). Stable 18 mo (Roche). Subset of Hae III sites. Activity determined on Ad-2 DNA (Pro). Still active after 5 hrs (BRL). Cuts well in PCR buffer (Roche). <10% activity in Pro(H) buffer (Pro). No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5' (BRL, Ph, Tak) or 3' (Ph, Tak) me-C; blocked by dcm methylation (NEB, Pro).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 50 mM KCl, 30° C digest; 50% activity loss with NaCl.
(3): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate; 0.1% BSA.


ApaL I
G'TGCAC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
NEB(4) -- ------- -- 1 (1)
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Sno I, Alw44 I, Vne I.
Inactivation Temp: Not inactivated at 60°C 15 min (Tak) or 65°C, 20 min (NEB); inactivated 70°C, 15 min (Amer, Tak).
Notes: Sequencing error in M13: no ApaLI site at base 4747 (A should be T) (NEB). After digest, fill-in, and ligation, site can be cut with Cac8 I, Nla III, Nsp I, or Sph I (NEB). No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate; 0.1% BSA.


Apo I
Pu'AATTPy
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 (1)
Digest Temp: 50°C (NEB; 50% activity at 37°C).
Isoschizomers: Acs I.
Other Compatible Ends: EcoR I.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: Star activity with low [salt], high [enzyme], >5% glycerol, or pH >8.0 (NEB). 30% activity at 37&# 176;C (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 0.1% BSA.


Asc I
GG'CGCGCC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1< /TD> (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Good for PFGE. After digest, fill-in, and ligation, site can be cut with BssH II, BstU I, Cac8 I, Hha I (NEB). Digests oligonucleotides with >90% efficiency without adjacent nt (NEB).
Methylation Effects: No cuts if if meC-G (NEB).
Other Buffer Components:
(1): 50 mM K-acetate; 20mM Tris-acetate (7.9); 10 mM Mg-acetate.


Ase I
AT'TAAT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: Asn I, PshB I, Vsp I.
Inactivation Temp: 65°C, 20 min (Amer, NEB, Ph).
Notes: About 80% of these fragments can be religated (Amer). Star activity with low [salt], high [enzyme], [glycerol]>5%, or pH>8.0 (NEB). Substrate preference observed (NEB). Removed from 2000 Amer catalog.
Methylation Effects: Unknown


Asn I
AT'TATT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 - (1)
Digest Temp: 37°C.
Isoschizomers: Ase I, PshB I, Vsp I.
Methylation Effects:< /B> Unknown
Other Buffer Components:
(1): 1 mM 2-ME.


Asp I
GACN'NNGTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 - (1)
< B>Digest Temp:
37°C.
Isoschizomers: Tth111 I (65°C digest).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM 2-ME.


Asp700 I
GAANN'NNTTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 - (1)
Digest Temp: 37°C.
Isoschizomers: Kpn I (which produces 3' ends), Acc65 I.
Notes: 3'meC blocks cutting for Asp but not Kpn. Not inhibited by up to 100-fol d excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). Cuts well in PCR buffer (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM 2-ME.


AspE I
GACNNN'NNGTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other< /TD>
Roche(L) -- 10(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: Ahd I, Eam1105 I, EclHK I.
Inactivation Temp: 15', 65°C (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE.


AspH I
G(AT)GC(TA)'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 - (1)
Digest Temp: 37°C.
Isoschizomers: Alw21 I, Bbv12 I, BsiHKA I.
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM 2-ME.


Ava I
C'PyCGPuG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (2)
Ph(M) 50 10(7.5) 10 1  
Pro(B) 50 6(7.5) 6 1  
Roche(B ) 100 10(8.0) 5 - (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C. 2.5x increased activity at 45°C (BRL).
Isoschizomers: Ama87 I, AquI, Avr I, Bco I, Eco88 I, BsoB I (65°C digest), Nsp III.
Other Compatible Ends: Acc III, Age I, Bca77 I, BsaW I, BseA I, BsiM I, BspE I, BsrF I, Bsu23 I, Cfr10 I, Kpn2, I, Mro I, NgoA IV, NgoM I, PinA1 I, Sal I, SgrA I.
Inactivation Temp: 70°C, 15 min (Amer, Tak); 80°C, 20 min (NEB); 85°C, 30 min (Ph); partially inactivated 65°C, 10 min (BRL), 15 min (Pro).
Notes: Glycerol >5% may alter specificity (BRL). Star activity with different buffers (Ph), in presence of high [glycerol] (Tak) or DMSO (Tak). Sensitive to DNA contaminants. 2.5x more active at 45°C vs 37°C (BRL). <10% activity at 100mM NaCl. No activity after ethanol precipitation (Tak). 10-25% activity in Pro(H) buffer (Pro). Still active after 5 hrs (BRL). Correlation between # sites & amount of enzyme needed. 20% activity in PCR buffer (Roche); cuts in PCR buffer (Pro). Don't use React 4 (BRL). Star activity with > 5% glycerol (BRL) or high [enzyme]. Activity determined on Ad-2 DNA (Pro). Need at least 2 nt on each side of the AvaI site for oligonucleotid digestion (NEB).
Methylation Effects: No cuts if 3' (BRL, NEB) 5me-C, or N6me-A (Ph, Tak). OK if 2nd me-C.
Other Buffer Components:
(1): 0.01% triton, 1 mM 2-ME.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


Ava II
G'G(AT)CC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Am er(M) 50 10(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (2)
Ph(L) -- 10(7.5) 10 1  
Pro(C) 50 10(7.9) 10 1  
Roche(A) -- ------- -- 0.5 (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: BamNx I, me18 I, Cau I, Cla II, Clm II, Fdi I, Eco47 I, HgiB I, HgiC II, HgiE I, HgiH III, NspH II, Sin I.
Other Compatible Ends: None.
Inactivation Temp: 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB, Ph); 70° 15 min (Amer, Tak). Residual activity after 60°C 15 min (Tak).
Notes: 75% activity inhibited by 80mM Tris-HCl pH 7.4. <10% activity at 100 mM NaCl (Pro). Sensitive to buffer composition & DNA contaminants. Star activity with high [glycerol] (Tak) or in presence of DMSO (Tak). Don't use React 4 buffer (BRL). Use 0.5 U/ug pBR322. Still active after 3 hrs at 37°C. <5% activity in PCR buffer (Roche). Partially digested in 1 hr, completely digested in 18 hrs (Pro). Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if hydroxy-me-C or 5-me-C, OK if N4-me-C (Ph); blocked by dcm methylation (NEB, Pro, Tak).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-a cetate; 50 mM K-acetate.


Avi II
TGC'GCA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Acc16 I, Fsp I.
Other Compatible Ends: Blunt.
Inactivation Temp: 70°C 15 min (Tak).
Notes: 30% activity in PCR buffer (Roche). Star activity in high pH (Tak) or in presence of DMSO (Tak). Residual activity after ethanol precipitation (Tak).
Methylation Effects: Cuts if N6-me-A (Tak), not if 1st C is 5me-C (Tak).
Other Buff er Components:
(1): 1 mM DTE.


Avr II
C'CTAGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C. Other Compatible Ends: Bln I, Nhe I, Spe I, Xba I; some Sty I sites.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes: After digest, fill-in, and ligation, site can be cut with Alu I, Bfa I (NEB).
Methylation Effects: Blocked by dam.


Bae I
5'-N(10)ACN(4)GTAYCN(12)'-3';3'-N(15)TGN(4)CATRGN(7)-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1 (1)
Digest Temp: 25°C.
Isoschizomers: Bbv II, Bbv16 I, Bpi I, BpuA I, Bsc91 I.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Excises its own 28 bp recognition site (NEB).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 100 µg/ml BSA & 20 µM S-adenosylmethionine.


Bal I
TGG'CCA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------- -- - (1)
Pro(G) -- 50(8.2) 5 -  
Tak(Basal) -- ------- -- --  :
Digest Temp: 37°C.
Isoschizomers: MluN I, Msc I.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°, 15 min (A mer, Tak); 65°C, 15 min (Pro) .
Notes: Very stable (up to 18 hours of cutting - can add a little enzyme for a long time), 0.06 U/µg for overnight digest. Activity varies with substrate & adjacent sequences. Residual activity after ethanol precipitation (Tak). HaeIII subset. Not recommended for cloning or sequencing. Moderately BAP resistant. Sensitive to DNA contaminants. 16 hrs for complete lambda digest; use 16 U/ug for lambda DNA. Sensitive to >25 mM NaCl. About 80% o f BalI fragments are religated (Pro). 25-50% activity at 25 °C (Pro).
Methylation Effects: Sensitive to dcm methylation (Pro, Tak). Cuts pBR322 at slow rate due to overlapping dcm methylase site (8 U/ug pBR322, 16 hrs).
Other Buffer Components:
(1): BalI Basal Buffer + BSA.


BamH I
G'GATCC
Source [NaCl] [Tris ](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (1)
BRL(3) 100 50(8.0) 10 -  
NEB(-) 150 10(7.9) 10 1 (3)
Ph(H) 100 50(7.5) 10 1  
Pro(E) 100 6(7.5) 6 1  
Roche(B) 100 10(8.0) 5 - (2)
Tak(K) -- 20(8.5) 10 1 (4)
Di gest Temp: 30°C digest (Amer); 37°C (NEB, Pro).
Isoschizomers: Aac I, BamF I, BamK I, BamN I, Bst I, Dds I, Gdy I, & Gox I.
Other Compatible Ends: Bcl I, Bgl II, BsiQ I, Bst I, BstY I, Dpn II, Mbo I, Mfl I, Nde II, Sau3A I, Xho II.
Inactivation Temp: Not inactivated 65°C, 10 min (BRL); inactivated at 60°C, 15 min (Amer, Tak), 65 °C 15 min (Pro), 80°C, 20 min (NEB); 85°C, 30 min (Ph).
Notes: BamH I1 activity if [glycerol] > 5% unless [NaCl] > 100 mM. Star activity (GGATCN & GPuATCC) with 50 mM NaCl or with Maniatis L or M buffers; with high [glycerol] (Tak). Star activity increases with high enzyme:DNA ratio (NEB) >25U/ug (Pro); Mn++ (Pro, Tak), low [salt] (Pro, Tak, NEB), DMSO (Tak), & pH >8.0 (NEB). Inhibited by [glycerol] >5% (NEB) or >12% (Pro). Use 2 U/µg pBR322 (BRL). Stable 18 mo. (Roche). Use 150 mM NaCl with high [enzyme]. Not active >2 hrs (BRL). Not active after ethanol precipitation (Tak). Sensitive to DNA contaminants (hydrophobic reagents & glycerol). Aggregates on aging, decreased efficiency & specificity. Cleaves oligonucleotide if at least 2 bases on each side of sequence (NEB). Cuts in PCR buffer (Pro). 100% activity in PCR buffer (Roche). Stable at pH 7.5-9.0 (Amer). Use proteinase-K & 0.1% SDS, then phenol/CHCl3 extract to thoroughly remove enzyme for efficient ligation. pUC19 vector double digests OK with KpnI, Xba I, Sal I, and Pst I; partial dige st with Sma I. 50-75% activity in Pro(H) buffer (Pro). Not active after 1-2 hrs. Correlation between # sites & amount enzyme needed. Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). Methylase available. Don't use React 2 buffer (BRL). After digest, fill-in, and ligation, site can be cut with Alw I, Cla I, Mbo I, Taq I (NEB).
Methylation Effects: Cuts if me-A (BRL, NEB, Ph, Pro, Tak), if 3' me-C (BRL, Ph, Tak), or if meC- G overlaps RE site (NEB); no cuts if 5' 5-me-C (BRL, Ph, Tak) or 4me-C (Tak), or if both C's are hemi-methylated (Tak);
Other Buffer Components:
(1): 100 mM KCl.
(2): 1 mM 2-me.
(3): 100µg/ml BSA.
(4): 100 mM KCl.

Ban I
G'GPyPuCC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- --- -- 0.5 (2)
NEB(4) -- ------- -- 1 (1)
Pro(G) -- 50(8.2) 5 -  
Roche(A) -- ------- -- 0.5 (2)
Digest Temp: 37°C (Amer, NEB); 50°C (Roche, Pro). 10-25% activity at 37°C (Pro).
Isoschizomers: AccB I, BshN I, Eco64 I, HgiC I, (& cuts some Hae II, Hha I, & Kpn I sites).
Inactivation Temp: 65°C, 20 min (Amer, NEB, Ph); not inactivated at 65°C, 15 min (Pro).
Notes: Inhibited by [NaCl] > 150 mM (NEB). pH stability = 7.5 - 7.9 (Amer). Removed from 2000 Amer ca talog.
Methylation Effects: Multiple meC-G overlaping RE site block cutting (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.


Ban II
GPuGCPy'C
< TD>[Mg++]
Source [NaCl] [Tris](pH) [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(1) -- 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (2)
Pro(E) 100 6(7.5) 6 1  
Roche(B) 100 10(8.0) 5 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Sac I, Apa I, HgiJ II, Eco24 I, EcoT38 I, FriO I.
Other Compatible Ends:
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB, Ph).
Notes: Inhibited by >5% [glycerol]. Star activity in high {glycerol] (Tak), in the presence of DMSO (Tak), or in low ionic strength (Tak). No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5' me-C (Tak). Dcm methylation sensitive at 5'C of GPyGCTC or GGGCCC. Cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1) : 60 mM KCl.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


Bbe I
GGCGC'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------- -- - (1)
Tak(Basal) -- ------- -- -- (1)
Digest Temp: 37°C.
Isoschizomers: Nar I (different cut site), Kas I, Nda I, Nun I, Ehe I.
Inactivation Temp: 60°C, 15 min (Amer, Tak).
Notes: Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5' C is 5me-C (Tak); cuts if either of the last two C's are 5me-C (Tak).
Other Buffer Components:
Notes: Removed from 2000 Amer catalog.
(1): Bbe I basal buffer.


BbrP I
CAC'GTG.
(1)
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 -
Digest Temp: 37°C.
Isoschizomers: PmaC 1, Pml I, Eco72 I.
Other Compatible Ends: Blunt.
Notes: 100% activity in PCR buffer (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM 2-me; pH at 37°C.


Bbs I
5'-GAAGACN2'-3';3'-CTTCTGN6'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: Bbv II, Bbv16 I, Bpi I, BpuA I, Bsc91 I.
Inactivation Temp: 65°C, 20 min (NEB, Amer). Store at -70°C for use > 30 days (NEB).
Methylation Eff ects: Cuts if meC-G overlaps RE site (NEB).


BbuI
GGATG'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(A) 6 6(7.5) 6 1  
Digest Temp: 37°C .
Isoschizomers: Sph I.
Other Compatible Ends: Hsp92 I, Nla III, Nsp I, Pae I, Sph I.
Inactivation Temp: 65°C, 15 min (Pro).
Notes: Sph I digests well in high salt conditions (Pro). 10-25% activity in Pro(H) buffer (Pro).
Methylation Effects: Unknown


Bbv I
5'-GCAGC(N)8'-3'//3'-CGTCG(N)12'-5'
< TD>[NaCl]
Source [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: Bst71 I.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Cuts 3' of last N on each strand. Ligation poor due to variable end structures. Activity varie s with substrate. More than half of these fragments can be religated. 4 bp overhanging extension.
Methylation Effects: Unknown


BbvC I
CC'TCAGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Bst71 I.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: None.
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM tris-acetate (7.9); 10 mM Mg-acetate.


Bcg I
5'-'N(10)CGAN(6)TGCN(12)'-3'//3'-'N(12)GCTN(6)ACGN(10)'-5'.
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(-) 100 10(8.4) 10 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Notes: Only restriction enzyme that cuts twice & cleaves out a 32 bp fragment containing its site (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 µM S-adenosylMet.


BciV I
5'-GTATCCN(6)'-3'//3'-CATAGGN(5)'-5'.
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(2) 50 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1  
Ph(H) 100 50(7.5) 10 1  
Pro(C) 50 10(7.9) 10 1  
Roche(M) 50 10(7.5) 10 - (1)
Digest Temp: 50°C under paraffin or mineral oil. 25-50% (Pro) or 50% active (NEB) at 37°C.
Isoschizomers: BsiQ I, FbaI, Ksp22 I.
Other Compatible Ends: BamH I, Bgl II, Bst I, BstY I, Dpn II, Mfl I, Mbo I, Mfl I, Nde II, Sau 3A I, Xho II
Inactivation Temp: Not inactivated 65°C, 20 min (BRL, NEB, Amer, Pro); inactivated at 85°C, 30 min (Ph).
Notes: pH 7.7 at 50°C = pH 8.4 at 25°. Still active after 5 hr digest; don't use React 2 (BRL). After digest, fill-in, and ligation, site can be cut with Cla I, Mbo I, or Taq I (NEB). Star activity with >12% glycerol (Pro), or >25U/ug enz:DNA (Pro). 50-75% activity in Pro(H) buffer (Pro).
Methylation Effects: No cuts of 5' 6me-A; use dam- E. coli strains which are partially resistant (BRL). h5me-C blocks cutting; 5me-C is cut (Ph); dam methylation sensitive (Pro).
Other Buffer Components:
(1): 0.01% (v/v) triton; optimal activity. at 50°C but only if at pH 7.7 at 50°C(=pH 8.4 at 25°C), 1 mM DTE.


Bcn I
CC(G/C)'GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Nci I.
Inactivation Temp: Not inactivated, use ethanol precipitation (Amer, Tak).
Notes: No ligation after cutting (Amer).
Methylation Effects: No cuts if 2nd C is 4me-C (Tak).


Bfa I
C'TAG
Source [NaCl] [Tris](pH) [Mg++]< /B> [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Mae I, Rma I.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: Store at -70°C (NEB). After digest, fill-in, and ligation, site can be cut with Sfc I (NEB).
Methylation Effects: Unknown
Other Buff er Components:
(1): 20 mM tris-acetate pH 7.9, 10 mM Mg-acetate, 50 mM K-acetate.


Bfr I
C'TTAAG.
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(M) 50 10(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: Afl II, BspT I, Bst98 I, MspC I, Vha464 I.
Inactivation Temp: 65°, 15 min (Roche).
Notes: No ligation without PEG 6000 (Roche). 100% active in PCR buffer (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE, pH at 37°C.


Bgl I
GCC(N)4'NGGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------- -- - (2)
BRL(2) 50 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1  
Ph(M) 50 10(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(Basal) -- ------- -- -- (2)
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: None.
Inactivation Temp: 60°C 15 min (Tak); 65°C, 10 min (BRL), 15 min (Amer, Pro), 20 min (NEB, Ph).
Notes: Moderately BAP resistant. 6 times more active at pH 9.5 than 7.5 (Roche, Ph); 2 times more activity at pH 8.0 than 7.4 (Ph). Stable 18 mo (Roche). Hard to clone due to variable ends. Susceptible to DNA contaminants. Star activity if in low salt (Tak). Use 8 U/µg for pBR322 (BRL); 0.5 U/µg for linear plasmid. BRL: activity decreases after 1 hr; don't use React 3 (BRL). 75-100% activity in Pro(H) buffer (Pro). Recognizes internal 6 bp of SfiI site & cuts at same place. Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5' or 3' me-C or internal m4-C (Ph, Tak); cuts if GC(5me-C)NGGC (Ph, Tak), not cut (Amer); cuts if either 5' C is 5me-C (BRL).
Other Buffer Components:
(1): 1 mM DTE.
(2): Bgl I basal buffer.


Bgl II
A'GATCT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(3) 100 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1  
Ph(H) 100 50(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(M) 50 10(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: BamH I, Bcl I, BsiQ I, Bst I, BstY I, Dpn II, Mbo I, Mfl I, Nde II, Sau3A I, Xho II.
Inactivation Temp: Not inactivated at 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB); inactivated at 70°C, 15 min (Amer, Tak); at 85°C, 30 min (Ph).
Notes: Stable 18 mo (Roche); we've had BRL enzyme that was still active after 3 yrs. Sensitive to DNA contaminants & different buffers. <10% active without NaCl (Pro). Star activity at low ionic strength (Tak). Very stable at room temperature. Activity decreases after 1 hr digest (BRL). 3 times more active at pH 9.5 than 7.5 (Amer), 2x at pH 8.0 (Ph). Stable between pH 7.0-9.5 (Amer). Use 8U/ µg pBR322 (BRL). Cleaves oligonucleotide if at least 2 bases on each side of sequence after 20 hrs, but inly 25% of oligonucleotides with 3 nt on each side after 2 hr digest (NEB). Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). Not active in PCR buffer (Roche). Don't use React 1 or 2 (BRL). Partially digested in 1 hr, complete in 18 hrs (Pro). After digest, fill-in, and ligation, site can be cut with Cla I, Mbo I, or Taq I (NE B). Residual acticity after ethanol precipitation (Tak).
Methylation Effects: No cuts of 5me-C (BRL, Ph, Tak) or hemi-methylated C (Tak); internal N6-me-A OK (BRL, Ph), not blocked by dam methylation (NEB, Pro).
Other Buffer Components:
(1): 1 mM DTE.


Bln I
C'CTAGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (1)
Roche(H) 100 50(7.5) 10 -- (2)
Tak(K) -- 20(8.5) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Av r II, Spe I, Xba I, some Sty I sites.
Inactivation Temp: Not inactivated at 65°C, 15 min (Roche,Amer) or 70°C 15 min (Tak); use ethanol precipitation (Amer, Tak).
Methylation Effects: Unknown
Other Buffer Components:
(1): 100 mM KCl.
(2): 1 mM DTE.


Blp I
GC'TNAGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Bpu1102 I, Bsp1720 I, Cel II.
Inactivation Temp: Not inactivated at 65°C, 20 min (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 mM tri s-acetate(7.9), 10 mM Mg-acetate, 50 mM K-acetate.


Bmr I
5'-ACTGGG(N)5'-3'//3'-TGACCC(N)4'-5'
Digest Temp: 37°C.
Isoschizomers: None.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Single 3' nucleotide makes ligation difficult; use high concentration T4 DNA ligase to increase ligation efficiency (NEB).
Methylation Effects: Unknown


Bmy I
G(GAT)GC(CTA)'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
[Tris](pH)
Source [NaCl] [Mg++] [DTT] Other
Roche(A) -- ------- -- 0.5 (1)
Digest Temp: 37°C.
Isoschizomers: Bsp1286 I, Aoc II, Nsp II, Sdu I.
Notes: Cleaves at 6 sequences.
Methylation Effects: Unknown
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate , 10 mM Mg acetate, pH 7.9 at 37°C.


Bpm I
5'-CTGGAG(N16'-3'//3'-GACCTC(N)14'-5')
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Gsu I.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Blocked by overlapping dcm methylation (NEB).
Methylation Effects: Blocked by dcm methylation (NEB).
Other Buffer Components:
(1): 100 µg/ml BSA.


Bpu1102 I
GC'TNAGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(2) 50 10(8.0) 10 -  
Tak(T) -- ------- -- 0.5 (1)
Digest Temp: 37°C.
Isoschizomers: Blp I, Bsp1720 I, Cel II, Esp I.
Inactivation Temp: Not inactivated at 65°C, 10 min (BRL), 70&176;C 15 min (Tak).
Notes: Active after 5 hrs (BRL). Residual activity after ethanol precipitation (Tak).
Methylation Effects: Unknown
Other Buffer Components: (1): 33 mM tris-acetate, pH 7.9; 10 mM magnesium acetate; 66 mM potassium acetate; 0.01% BSA.


BpuA I
5'-GAAGACN2'N4-3'//3'-TTCTGN6'N-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 - (1)
Digest Temp: 37°C.
Isoschizomers: Bbs I, Bbv16 I, Bpi I.
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM 2-me.


Bsa I< BR> 5'-GGTCTCN(1)'-3'//3'-CCAGAGN(5)'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 --
Digest Temp: 50°C.
Isoschizomers: Eco31 I.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: 10% activity at 37°C (NEB).
Methylation Effects: Unknown
Other Buffer Components:None.


BsaA I
PyAC'GTPu
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 37°C.
Other Compatible Ends: Blunt.
Inactivation Temp: Not inactivated at 65°C, 20 min (Amer); inactivated at 80°C, 20 min (NEB).
Methylation Effects: No cuts if meC-G (NEB).


BsaB I
GATNN'NNATC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 60°C (NEB, Amer).
Isoschizomers: Bse8 I, Bsh1365 I, BsrBR I, Mam I.
Other Compatible Ends: Blunt.
Inactivation Temp: Not inactivated at 65°C, 20 min (Ame r); inactivated at 80°C, 20 min (NEB).
Notes: 20% activity at 37°C (Amer, NEB).
Methylation Effects: Blocked by dam methylation (NEB); rate slowed significanntly if meC-G overlaps RE site (NEB).


BsaH I
GPu'CGPyC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Oth er
NEB(4) -- ----- -- 1 (1)
Digest Temp: 37°C; 2 times increased activity at 60°C (NEB).
Isoschizomers: Acy I, Aha II, Bbi II, Hin1 I, Hsp92 I, Msp17 I.
Inactivation Temp: 80°C, 20 min (NEB).
Methylation Effects: No cuts if meC-G (NEB).
Other Buffer Components:
(1): 50 mM K-acetate; 20mM Tris-acet ate; 10 mM Mg-acetate; pH 7.9, 0.1% BSA.


BsaJ I
C'CNNGG.
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 60° ;C.
Isoschizomers: BseD I, Sec I.
Inactivation Temp: Not inactivated 65°C, 20 min (Amer); inactivated 80°C, 20 min (NEB).
Notes: 20% activity at 37°C (Amer, NEB).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).


BsaM I
5'-GAATGAN'-3'//3'-CTTAC'GN-5'.
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(D) 150 6(7.9) 6 1  
Digest Temp: 65°C; <10% activity at 37°C (Pro).
Isoschizomers: Bsm I, Mva1269 I.
Other Compatible Ends:
Inactivation Temp: Not inactivated 65°C, 15 min (Pro).
Notes: <10% ac tivity at 37°C (Pro).
Methylation Effects: Unknown


BsaO I
CG(A/G)(T/C)'CG
Digest Temp: 50°C; 25-50% activity at 37°C (Pro).
Isoschizomers: Bsh1285 I, BsiE I, BstMC I, Mcr I (cuts at different position).
Other Compatible Ends:
Inactivation Temp:Not inactivated 65°C, 15 min (Pro).
Notes: None.
Methylation Effects: Unknown


BsaW I
(AT)'CCGG(AT)
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(C) 50 10(7.9) 10 1  
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1 (1)
Digest Temp: 60°C. 25% activity at 37°C (NEB).
Isoschizomers: BetI, Bca77I.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: 25% activity at 37° (NEB).
Methy lation Effects: Cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 0.1% BSA,


BsaX I
5'-N9ACN5CCn10'-3'//3'-'N12TGN5GAGGN7-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ----- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers:
Inactivation Temp: Not heat inactivated (NEB).
Notes:
Methylation Effects: Unknown.
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM Tris-acetate (7.9), 10 mM Mg-acetate.


BseA I
T'CCGGA.
< TD>Source
[NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 - (1)
Digest Temp: 55°C.
Isoschizomers: Acc III, BsiM I, Bsp13 I, BspE I, Kpn2 I, Mro I.
Inactivation Temp: Not inactivated 65°C, 15 min; 55°C digest (Roche).
Notes: None.
Methylation Effects: Methylase sensitive.
Other Buffer Components:
(1): 1 mM 2-me.


BseR I
5'-GAGGAGN(10)'-3'//3'-CTCCTCN(8)'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Don't cut with > 10U/µg of DNA or for >2hr (NEB).
Methylation Effects: Unknown


Bsg I
GTGCAG(N(16)'//N(14)')
Source [NaCl] [T ris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Requires 80µM S-adenosylmethionine; 25% activity without it (NEB).
Methylation Effects: No cuts if meC-G overlaps RE site (NEB).
Other Buf fer Components:
(1): 50 mM K-acetate; 20mM Tris-acetate; 10 mM Mg-acetate; pH 7.9; 80µM S-adenosylMet.


BsiE I
CGPuPy'CG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1 (1)
Digest Temp: 60°C. 30% activity at 37°C (NEB).
Isoschizomers: BsaO I, Bsh1285 I, BstMC I, Mcr I.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: 30% activity at 37°C (NEB).
Methylation Effects: No cuts if meC-G in RE site (NEB).
Other Buffer Components:
(1): 0.1% BSA.


BsiHKA I
G(A/T)GC(A/T)'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.0) 10 1 (1)
Digest Temp: 65°C.
Isoschizomers: Alw21 I, AspH I, Bbv12 I, HgiA I.
Inactivation Temp: 80°C, 20 min (NEB).
No tes: Little activity at 37°C (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 0.1% BSA.


BsiM I
T'CCGGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
Digest Temp: 55°C.
Isoschizomers: Acc III, BseA I, Bsp13 I, BspE I, Kpn2 I, Mro I.
Inactivation Temp: Not inactivated (Amer).
Notes: Removed from 2000 Amer catalog.
Methylation Effects: Unknown


BsiW I
C'GTACG
Source [N aCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Roche(H) 100 50(7.5) 10 -- (1)
Digest Temp: 55°C (Roche, NEB), 60°C (Amer). 50% activity at 37°C (NEB).
Isos chizomers: Pfl23 II, PspL I, Spl I, Sun I.
Inactivation Temp: 1 hr, 75°C (Roche), 80°C, 20 min (NEB).
Notes: Rare cutter. 50% activity at 37° (NEB). After digest, fill-in, and ligation, site can be cut with BsaA I, BsiW I, Mae II, Rsa I, or SnaB I (NEB).
Methylation Effects: No cuts if meC-G in RE site (NEB).
Other Buffer Components:
(1): 1 mM DTE.


BsiY I
CCN(5)'N(2)GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(M) 50 10(7.5) 10 -- (1)
Digest Temp: 55°C (Amer, Roche).
Isoschizomers: Bsc4 I (different cut site), Bsl I.
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE.


Bsl I
CCNNNNN'NNGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 55°C.
Isoschizomers: Bsc4 I (different cut site), BsiY I.
Inactivation Temp: Not inactivated 65°C, 20 min; use 80°C, 20 min (NEB).
Notes: 30% activity at 37°C (NEB).
Methylation Effects: No cuts if meC-G overlaps RE site (NEB).


Bsm I
5'-GAATGCN'-3'//3'-CTTAC'GN-5'
Source [ NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(2) 50 10(8.0) 10 -  
NEB(2) 50 10(7.9) 10 1 &n bsp;
Roche(H) 100 10(7.5) 10 -- (1)
Digest Temp: 65°C. 20% activity at 37°C (NEB).
Isoschizomers: BsaM I.
Isoschizomers: BsaM I, Mva1269 I.
Inactivation Temp: Not inactivated 65°C, 10 min (BRL), 20 min (Amer); inactivated 80°C, 20 min (NEB).
Notes: 20% activity at 37°C (NEB). Removed from 2000 Amer catalog.
Methylation Effects: uts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 1 mM DTE.


BsmA I
5'-GTCTCN(1)'-3'//3'-CAGAGN(5)'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 55°C.
Isoschizomers:Alw26 I.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: 30% activity at 37°C, 10% at 65°C (NEB).
Methylation Effects: No cuts if meC-G overlaps RE site (NEB).


BsmB I
CGTCTCN(1'//5')
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 55°C.
Isoschizomers: Esp3 I.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: 20% activity at 37° (NEB).
Methylation Effects:< /B> Unknown


BsmF I
GTCCCN(10)'//(14)')
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- -- -- 1 (1)
Digest Temp: 65°C. 50% activity at 37° C (NEB).
Isoschizomers: FinI.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: May also cleave GGGAC(9/13) at undetermined frequency (NEB). 50% active at 37° (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 mM tris-acetate(7.9), 10 mM Mg-acetate, 50 mM K-acetate.


BsoB I
C'PyCGPuG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: Ava I, Ama87 I, Bco I, Eco88 I.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes: Incubation temperature reduced from 65°C in NEB 2000-01 catalog to reduce star activity (NEB). Low ionic strength (NEB), high [enzyme] (NEB), [glycerol] >5% (NEB), or pH > 8.0 (NEB) may result in star activity.
Methylation Effects: Unknown


BsoF I
GCNGC
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Isoschizomers: Fnu4H I, Ita I.
Notes: Used to be sold by NEB (buffer 2). Replaced with Fnu4H I .
Methylation Effects: No cuts if meC-G overlaps RE site (NEB).


Bsp1286 I
G(G/A/T)GC(C/A/T)'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1 &nbs p;
NEB(4) -- ----- -- 1 (1)
Pro(A) 6 6(7.5) 6 1  
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 30°C digest (Amer), 37°C (Pro, NEB).
Isoschizomers: Bmy I, Aoc II, Nsp II, Sdu I.
Other Compatible Ends:
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C 15 min (Pro), 20 min (NEB).
Notes: Palindrome in parentheses of recognition site is not needed; enzyme recognizes 6 sequences (NEB). Inhibited by >100 mM NaCl. About 85% of Bsp1286I ends can be religated (Pro). Incomplete digest after 18 hrs in PCR buffer (Pro). No activity after ethanol precipitation (Tak).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM Tris-acetate (7.9), 10 mM Mg-acetate, 0.1% BSA.


Bsp1407 I
T'GTACA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Tak(T) -- ------- -- 0.5 (1)
Digest Temp: 37°C (Tak).
Isoschizomers: None.
Other Compatible Ends:
Inactivation Temp: 70°C, 15 min (Tak).
Notes: Residual activity after ethanol precipitation (Tak).
Methylation Effects: Unknown.
Other Buffer Components:
(1): 33 mM tris-acetate (7.0), 10 mM magnesium acetate, 66 mM potassium acetate, 0.01% BSA.


BspD I
AT'C GAT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Isoschizomers: Ban III, Bsa29 I, Bsc I , BseC I, Bsp106 I, BspX I, Bsu15 I, Cla I.
Notes: After digest, fill-in, and ligation, site can be cut with BstU I, or Nru I (NEB).
Methylation Effects: No cuts if dam methylation (NEB); No cuts if meC-G (NEB).
Other Buffer Components:
(1): 50 mM K-acetate; 20mM Tris-acetate; 10 mM Mg-acetate; pH 7.9.


BspE I
T'CCGGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: AccIII, BseA I, BsiM I, Bsp13 I, Kpn2 I, Mro I.
Inactivation Temp: 80°C 20 min (NEB).
Notes: After digest, fill-in, and ligation, site can be cut with BsiE I, Eae I, Eag I, Hae III, Hpa II (NEB) .
Methylation Effects: Blocked by dam methylation (NEB); cuts if meC-G (NEB).


BspH I
T'CATGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- ------- -- 0.5 (2)
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Rca I.
Inactivation Temp: 65°C, 20 min (Amer, NEB).
Notes: Store at -70°C for long term storage (NEB-earlier than 1998/99 catalog). After digest, fill-in, and ligation, site can be cut with Nla III or Nsi I (NEB). Removed from 2000 Amer catalog.
Methylati on Effects: Blocked by dam methylation (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): 33 mM Tris-acetate (7.9); 10 mM Mg-acetate; 66 mM K-acetate.


BspLU11 I
A'CATGT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(H) 100 50(7.5) 10 -- (1)
Digest Temp: 48°C (Roche).
Isoscizomers: Pci I.
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE.


BspM I
ACCTGCN((4)'//(8)')
Sourc e [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: M13mp18 & 19 polylinker & pBR322 sites are resistant (100-fold excess enzyme cuts < 50% DNA) (NEB). Other plasmid sites may be resistant to cleavage (NEB).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).


Bsr I
5'-ACTGGN'-3'//3'- TGAC'CN-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 65°C.
Isoschizomers: Bse1 I, BseN I, BsrS I.
Inactivation Temp: 80°C, 20 min (NEB, Amer).
Notes: 20% activity at 37°C (NEB).
Methylation Effects: Unknown


BsrB I
5'-GAG'CGC-3'//3'-CTC'GCC-5'
Source [NaCl]< /TD> [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C; but fully active at 50°C (NEB).
Isoschizomers: AccBS I.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: Non-palindromic recognition site. About half of these religated fragments have BsrB I sites; other sites may be cleaved with SacI or SacII (NEB). Fully active at 50°C (NEB).
Methylation Effects: Cuts if meC-G overlaps RE site but at a slower rate (NEB).


BsrBR I
GATNN'NNATC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(H) 50 90(7.5) 10 --  
Digest Temp: 65°C; 10-25% activity at 37 °C (Pro).
Isoschizomers: BsaB I, Bse8 I, Bsh1365 I, Mam I.
Other Compatible Ends: Blunt.
Inactivation Temp: Not inactivated at 65°C, 15 min (Pro).
Notes: Star activity with Pro(B) or Pro(C) buffers.
Methylation Effects: Sensitive to dam met hylation (Pro).


BsrD I
5'-GCAATGNN'-3'//3'-CGTTAC'NN-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1 (1)
Digest Temp: 60°C. Inactivation Temp: 80°C, 20 min (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 0.1% BSA.


BsrF I
Pu'CCGGPy
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 5 0 10(7.9) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Cfr10 I.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Isoschizomers: Bse118 I, BssA I, Cfr10 I.
Notes: Star activity with low ionic strength, high [enzyme], >5% glycerol, or pH >8.0 (NEB).
Methylation Effects: No cuts if meC-G (NEB).
Other Buffer Components:
(1): 0.1% BSA.

BsrG I
T'GTACA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1 (1)
Digest Temp: 37°C; 2 times more activity at 60°C (NEB).
Isoschizomers: Bsp1407 I, SspB I.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB); inactivate 80°C, 20 min (NEB).
Notes: After digest, fill-in, and ligation, site can be cut with BsaA I, Mae II, Rsa I, SnaB I (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 0.1% BSA.


BsrS I
5'-AGTGGN'-3'//3'-TGAC'CN-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(D) 150 6(7.9) 6 1  
Digest Temp: 65°C (Pro).
Isoschizomers: Bsr I, BseN I, Bse1 I.
Other Compatible Ends: None.
Inactivation Temp: Not inactivated at 6 5°C (Pro).
Methylation Effects: Unknown


BssH II
G'CGCGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- --- -- 0.5 (2)
BRL(2) 50 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1  
Ph(H) 100 50(7.5) 10 1  
Pro(H) 50 90(7.5) 10 --  
Roche(A) -- --- -- 0.5 (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C (Ph); 50°C (Amer, NEB, Pro); >75% activity at 37°C (NEB, Pro).
Isoschizomers: BseP I, Pau I.
Other Compatible Ends: Asc I, Dsa I, Mlu I.
Inactivation Temp: 65°C, 10 min (BRL); 70°C 15 min (Tak); 80°C, 20 min (NEB); 85°C, 30 min (Ph); not inactivated 65°C, 15 min (Pro, Amer); use ethanol precipitation (Amer).
Notes: Rare cutter, about 100 kb mammalian DNA fragments generated (BRL). Not active after 2 hrs (BRL). Inhibited by > 150 mM NaCl (Amer). Star activity reported (Ph). >75% (NEB), 75-100% (Pro) activity at 37°C. After digest, fill-in, and ligation, site can be cut with BssH II, BstU I, Cac8 I, or Hha I (NEB). Oligonucleotides with 3 adjacent nt are digested 50% after 2 hrs and > 90% after 20 hrs (NEB). At least 85% of ends are ligated overnight (BRL). Residual activity after ethanol precipitation (Tak).
Methylation Effects: Not cut if 5' 5me-C (Ph, Tak); no cuts if meC-G (NEB).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 33 mM tris-acetate (7.9); 10 mM Mg-acetate;66 mM K-acetate.


BssK I
'CCNGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 (1)
Digest Temp: 60°C.
Isoschizomers: ScrF I (different cut site), MspR9 I (dif ferent cut site).
Inactivation Temp: 80°C 20 min (NEB).
Methylation Effects: Unknown


BssS I
C'TCGTG
< TD>1
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10  
Digest Temp: 37°C; 50% increased activity at 60°C (NEB).
Isoschizomers: Bsi I, Bst2B I.
Inactivation Temp: 80°C, 20 min (NEB).
Notes: Star activity with low [salt], > 10U enzyme/µg of DNA, or >2hrs digestion (NEB).
Methylation Effects: Unknown


Bst71 I
5'-GCAGCN8'-3'//3'-CGTCGN12'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(D) 150 6(7.9) 6 1  
Digest Temp: 50°C; 50-75% activity at 37°C (Pro).
Isoschizomers: Bbv I.
Other Compatible Ends: None.
Inactivation Temp: Not inactivated at 65°C, 15 min (Pro).
Notes: Star activity with low [salt] (Pro).
Methylation Effects: Unknown


Bst98 I
C'TTAAG
< TD>6(7.9)
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(D) 150 6 1  
Digest Temp: 37°C (Pro). Has twice the activity at 60°C (Pro).
Isoschizomers: Afl III, Bfr I, BspT I, MspC I, Vha464 I.
Other Compatible Ends: None.
Inactivation Temp: Not inactivated at 65 °C 15 min (Pro).
Notes: Activity determined on Ad-2 DNA (Pro). 2 times more active at 60°C (Pro).
Methylation Effects: Unknown


Bst1107 I
GTA'TAC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(H) 100 50(7.5) 10 -- (1)
Tak(K) -- 20(8.5) 10 1 (2)
Digest Temp: 37°C.
Isoschizomers: Sna I, Xca I.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 20 min (NEB); not heat inactivated 70°C 15 min (Tak); use phenol (Tak) .
Notes: Star activity in low salt (Tak). Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if meC-G overlaps RE site (NEB, Tak).
Other Buffer Components:
(1): 1 mM DTE.
( 2): 100 mM KCl.


BstAP I
GCANNNN'NTGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(SE-W) 100 10(8.5) 10 1  
Digest Temp: 60°C (NEB).
Isoschizomers:
Inactivation Temp: 80°C, 20 min (NEB).
Notes: RE from SibEnzyme.
Methylation Effects: Unknown


BstB I
TT'CGAA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------ - -- 1 (1)
Digest Temp: 65°C (10% activity at 37°C - NEB).
Isoschizomers: Asu II, Bpu14 I, BsiC I, Bsp119 I, Cbi I, Fsp II, Csp45 I, Lsp I, Nsp V, Sfu I.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes: 10% activity at 37°C (NEB). After digest, fill-in, and ligation, site can be cut with BstU I or Nru I (NEB).
Methylation Effects: No cuts if meC-G (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


BstDS I
C'CRYGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(1) -- ------- -- 1 (1)
Digest Temp: 65°C.
Isoschizomers: Btg I.
Inactivation Temp: Not heat inactivated at 65°C, 20 min (NEB).
Methylation Effects: Unknown
Notes: From SibEnzyme; replaced by Btg I (2000-01 NEB catalog).
Other Buffer Components:
(1): 66 mM K-acetate; 33 mM Tris-acetate (7.9); 10 mM Mg-acetate.


BstE II
G'GTNACC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(2) 50 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(B) 100 10(8.0) 5 - (1)
Digest Temp: 60°C (NEB, Pro); 10% (NEB), 25-50% (Pro) activity at 37°C.
Isoschizomers: AspA I, BstP I, Eca I, EcoO65 I, Eco91 I, FspA I, PspE I.
Other Compatible Ends:
Inactivation Temp: 85°C, 30 min (Ph); < U>not inactivated 65°C, 10 min (BRL), 20 min (Amer, NEB, Pro).
Notes: Store at 4°C. Rare cutter. One of 3 enzymes that produces >4 base extension (BstE II, EcoR II, Hga I). <10% activity at 50mM NaCl (Pro). Still active after 5 hr digest. Activity decreases >1hr (BRL). Don't use React 4 buffer (BRL). pH stability = 7.0 - 9.0 (Amer). 2-4x less active at 37°C (Pro). 10% of oligonucleotides with one adjacent nt are digested after 20 hrs (NEB). Star activity with > ;12% glycerol (Pro) or > 25U/ugenz:DNA (Pro).
Methylation Effects: Not sensitive to 5me-CG (BRL, NEB).
Other Buffer Components:
(1): 1 mM 2-me.


BstF5 I
GGATGNN'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(SE-Y) -- ------- -- 1 (1)
Digest Temp: 65°C (NEB).
Isoschizomers:
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes: RE from SibEnzyme in 1998/99 NEB catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 33 mM Tris-acetate (7.9); 10 mM Mg-acetate; 66 mM K-acetate.


BstN I
CC'(A/T)GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1 (1)
Digest Temp: 60°C (NEB); 30% activity at 37°C (NEB).
Isoschizomers: Bst2U I, EcoR II (/CC(AT)GG), Apy I, Mva I, BstO I, PspG I.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes: Little/no ligation after cutting; needs fill-in reaction with Klenow first, ligation efficiency increases with 15% PEG (NEB). We had NEB enzyme that still cut after 4 yrs. <10% activity at 50mM NaCl (Pro). Cleaves ssDNA slowly. Cuts in PCR buffer (Pro). 60°C is 3 times more active than at 37°C (NEB).
Methylation Effects: Apy I requires 5' me-C; BstN I cuts dcm methylated DNA (NEB), un like EcoR II, unless its 4me-C.
Other Buffer Components:
(1): 0.1% BSA.


BstO I
CC'(A/T)GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(C) 50 10(7.9) 10 1  
Digest Temp: 60°C. 25-50% activity at 37°C (Pro).
Isoschizomers: Apy I, Bst2U I, BstN I, EcoR II (different cut site), Mva I, PspG I.
Compatible Ends:
Inactivation Temp: Not inactivated at 65°C, 15 min (Pro).
Notes: None of these fragments can be religated (Pro).
Methylation Effects: Not sensitive to dcm methylation (Pro).


BstP I
G'GTN ACC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C (??).
Isoschizomers: BstE II.
Compatible Ends:
Inactivation Temp: Not inactivated at 70°C, 15 min (Tak).
Notes: Star activity with high [glycerol] (Tak) or at low ionic strength (Tak). No activity after ethanol precipitation (Tak).
Methylation Effects: Cut if 3' C is 5me-C (Tak).


BstU I
CG'CG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 60°C (NEB); 20% activity at 37°C (NEB).
Isoschizomers: Acc II, Bsh1236 I, FnuD II, Mvn I, Tha I.
Other Compatible Ends: Blunt.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB, Amer).
Notes: Between 25% - 75% (NEB) of fragments c an be religated. 20% activity at 37°C (NEB, Amer).
Methylation Effects: No cuts if meC-G (NEB).


BstX I
CCAN(5)'NTGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(3) 100 10(7.9) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Digestion temp: 45°C (Roche, Tak); 50°C (Amer, Pro); 55°C (NEB); 50% (NEB), 75-100% (Pro) activity at 37°lC; little activity at 65°C (NEB).
Isoschizomers: BssG I.
Other Compatible Ends:
Inactivation Temp: 60°C 15 min (Tak); 65°C, 10 min (BRL), 20 min (Amer, NEB); partially inactivated 65°C, 15 min (Pro, BRL).
Notes: <10% activity if no NaCl (Pro). DNA partially digested in 1 hr, complete in 18 hrs (Pro). Not active after >1 hr digest (BRL). 50% (NEB), 75-100% (Pro) activity at 37°C; doesn't cut well at 65°C (NEB). 75-100% activity in Pro(H) buffer (Pro). No activity after ethanol precipitation (Tak). Oligonucleotides with 10 adjacent 5' nt and 2 adjacent 3' nt are cut wih 25% efficiency after 2 hrs or 50% efficiency after 20 hrs; >90% efficiency with 8 5' adjacent nt and 6 3' nt (NEB). At least 85% of ends are ligated overnight (BRL).
Methylation Effects: No cuts if 5'me-C (Tak); OK if me-A (?) or if last N is 5me-C (Tak).
Other Buffer Components:
(1): 1 mM DTE, pH at 37°C, 45°C digest.


BstY I
Pu'GATCPy
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(2) 50 50(8.0) 10 -  
NEB(-) -- 10(7.9) 10 1 (1)
Digest Temp: 60°C (NEB); 30% activity at 37°C (BRL, NEB).
Isoschizomers: Bs tX2 I, Mfl I, Xho II.
Inactivation Temp: Not inactivated at 65°C, 10 min (BRL, Amer); inactivated at 80°C, 20 min (NEB).
Notes: Use 8 U/µg for pBR322. Not active >1 hr digest. 30% activity at 37°C (NEB, Amer).
Methylation Effects: Not blocked by dam methylation (BRL); cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 0.1% BSA.


BstZ I
C'GGCCG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(D) 150 6(7.9) 6 1  
Digest Temp: 50°C. 50% activity at 37 °C (Pro).
Isoschizomers: Eag I, EclX I, Eco52 I, Xma III.
Other Com patible Ends: Eae I, Not I.
Inactivation Temp: Not inactivated at 65°C, 15 min (Pro).
Notes: Activity determined on EcoR I fragments of lambda DNA (Pro).
Methylation Effects: Unknown


BstZ17 I
GTA'TAC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: Bst1107 I.
Other Compatible Ends: Blunt.
Inactivation Temp: Not inactivated 65°C 20 min (NEB).
Notes: Star activity with >10 U/µg DNA (NEB). Methylation Effects: Unknown


Bsu36 I< /B>
CC'TNAGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 (1)
Pro(E) 100 6(7.5) 6 1  
Digest Temp: 37°C.
Isoschizomers: Aoc I, Axy I, Bse21 I, Cvn I, Eco81 I, Mst II, Sau I, OxaN I.
Other Compatible Ends:
Inactivation Temp: Not inactivated at 65°C 15 min (Pro); inactivated 80°C, 20 min (NEB).
Notes: Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). About 80% of these fragments can be (but are difficult) religated (Pro).
Methylation Effects: Unknown
Other Buffer Components:
(1): 0.1% BSA.


Btg I
C'CRYGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 ( 1)
Digest Temp: 60°C.
Isoschizomers: BstDS I, Dsa I.
Inactivation Temp: Not heat inactivated (NEB).
Methylation Effects: Unknown
Notes: From SibEnzymes, sold by NEB. > 80% of cut DNA ccan be religated (NEB).
Other Buffer Components:
(1): 100 µg/ml BSA.


Btr I
CAC'GTG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(SEB-3-O) 100 50(7.5) 10 1  
Digest Temp: 60°C.
Isoschizomers: None.
Inactivation Temp: 80°C, 20 min (NEB).
Methylation Effects: Unknown
Notes: From SibEnzymes, sold b y NEB. > 80% of cut DNA can be religated (NEB).


Bts I
5'-GCAGTGNN'-3' //3'-CGTCAC'-5'
NEB(4) -- -- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: None.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: About 75% of the fragments can be ligated )NEB).
Methylation Effects: Unknown.
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM Tris-acetate (7.9), 10 mM Mg-acetate; 100 µg/ml BSA.


Cac8 I
GCN'NGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 37°C.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 20 min (NEB).
Methylation Effects: Unknown


Cel II
GC'TNAGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
Roche(H) 100 50(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: Blp I, Bpu1102 I, Bsp1720 I, Esp I.
Other Compatible Ends: AocI, DdeI, SauI. < BR> Inactivation Temp: Not inactivated; phenol extract (Amer).
Notes: About 80% of these fragments can be religated (Amer).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE.


Cfo I
GCG'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(1) -- 50(8.0) 10 -  
Pro(B) 50 6(7.5) 6 - (1)
Roche(L) -- 10(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: AspLE I, Hha I, Hin6 I (different cut site), HinP1 I (different cut site), HspA I (different cut site).
Other Compatible Ends:
Inactivation Temp: partially resistant to inactivated at 65°C 10 min (BRL), 15 min (Pro).
Notes: Inhibited (like HhaI) if 5' meC. Highly BAP resistant. Activity varies with substrate. Use 4 U/ug for pBR322 (BRL). Also good cutting in React 4 buffer, unknown cut site, not active after 1 hr digestion (BRL).
Methylation Effects: No t cut if 5me-C (BRL).
Other Buffer Components:
(1): 1 mM DTE.


Cfr10 I
Pu'CCGGPy
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- 20(7.5) - - (1)
Roche(B) 100 10(8.0) 5 - (2)
Tak(Basal) -- ------- -- --  
Digest Temp: 37°C.
Isoschizomers: Bse118 I, BsrF I, BssA I.
Other Compatible Ends: AccI, BspMII, BsrFI, CfrI, Eco52 I, Mro I, Xcy I, XmaI.
Inactivation Temp: Not heat inactivated (Amer, Tak), phenol extract (Amer).
Notes: Need 8U/µg to cut M13. Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if meC-G (NEB, Tak).
Other Buffer Components:
(1): old catalog= 3 mM MgSO4, 100 mM KCl, 0.02% triton X-100; 1996 & 1998 catalog: use Cfr10I basal buffer.
(2): pH at 37°C, 1 mM 2-me.
(3): Cfr10 I basal buffer.


Cfr13 I
G'GNCC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Tak(K) -- 20(8.5) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Asu I, Sau96 I.
Other Compatible Ends:
In activation Temp: 60°C 15 min (Tak).
Notes: Not active after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5meC (Tak).
Other Buffer Components:
(1): 100 mM KCl.


Cla I
AT'CGAT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(1) -- 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (2)
Ph(M) 50 10(7.5) 10 1  
Pro(C) 50 10(7.9) 10 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 30°C for >3hrs; 37°C for shorter dig ests (Amer); 37°C (NEB, Pro).
Isoschizomers: Ban III, Bsa29 I, Bsc I, BseC I, BsiX I, Bsp106 I, BspD I, BspX I, Bsu15 I.
Other Compatible Ends: Aci I, Acy I, Aha II, Asu II, Bbi II, BsaH I, BsiC I, Bsp106 I, BstB I, Csp45 I, Hap II, HgiD I, Hin1 I, HinP I, HinP1 I, Hpa II, Hsp92 I, Mae II, Msp I, Nar I, Nsp V, Nsp7524 V, Nun II, Psp1406 I, Sfu I, Taq I, TthHB8 I, Yaq I.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C 10 min (BRL partially resistant), 15 min (Pro), 20 min (NEB, Ph).
Notes: Cleaves in Tc promoter of pBR322, usually gives TcR. Add 2 bases on each side for >90% digestion; but 3 nt to each side reduces efficiency to 50% (NEB). Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). Methylase available. 100% activity in PCR buffer (Roche). Stable for 18 mo. (Roche). <10% activity with 150 NaCl (Pro); 50-75% activity in Pro(H) buffer (Pro). Still active after 5 hr digest (BRL). No activity after ethanol precipitation (Tak). Correlation between # sites & amount of enzyme needed. Don't use with React 2, 3 or 4 (BRL). After digest, fill-in, and ligation, site can be cut with Cla I, Dpn II, Mo I, Sau3A I, or Taq I (NEB).
Methylation Effects: No cuts if 5me-C (BRL, Ph, NEB, Tak), 5' (Ph, Tak) or 3' N6me-A (BRL, Ph, Tak); no cutting (NEB, Pro) or partial cutting (BRL) in dam strains.
Other Buffer Components:
(1): 1 mM DTE.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate; 0.1% BSA.


Cpo I
CG'G(A/T)CCG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (1)
Tak(K) -- 20(8.5) 10 1 (1)
Digest Temp: 30°C digest.
Isoschizomers: Csp I, Rsr II.
Inactivation Temp: 60°C 15 min (Amer, Tak).
Notes: Not active after ethanol precipitation (Tak).
Methylation Effects: No cuts if 2nd or 3rd C in 5me-C (Tak).
Other Buffer Components:
(1): 100 mM KCl.


Csp I
C G'G(A/T)CCG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(K) -- 10(7.4) 10 - (1)
Digest Temp: 30°C digest; 50-75% activity at 37°C (Pro).
Isoschizomers: Cpo I, Rsr II.
Oth er Compatible Ends:
Inactivation Temp: 65°C, 15 min (Amer, Pro).
Notes: 50-75% activity at 37°C (Pro). 100% activity in Pro(H) buffer (Pro).
Methylation Effects: Unknown
Other Buffer Components:
(1): 150 mM KCl.


Csp6 I
G'TAC
Source [NaCl] [Tris](pH) [Mg++ ] [DTT] Other
NEB(B) -- 10(7.5) 10 -  
Digest Temp: 37°C.
Isoschizomers: Afa I (different cut site), Rsa I (different cut site).
Inactivation Temp: 65°C, 20 min (NEB).
Notes: After digest, fill-in, and ligation, site can be cut with Acc I or Bst1107 I (NEB). Not in 1998/99 NEB catalo g.
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).


Csp45 I
TT'CGAA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(B) 50 6(7.5) 6 1  
Digest Temp: 30°C (?); 37°C (Pro).
Isoschizomers: Asu II, Bpu14 I, Bsp119 I, BstB I, BsiC I, Cbi I, Lsp I, Nsp V, Sfu I.
Other Compatible Ends: Acy I, Aha II, Ban III, Bbi II, Cla I, Hap II, Hin1 I, HinP I, Hpa II, Mae II, Msp I, Nar I, Sfu I, Taq I, TthHB8 I.
Inactivation Temp: 65°C, 15 min (Pro).
Notes: 25-50% activity in Pro(H) buffer (Pro).
Methylation Effects: Unknown


Cvn I
CC'TNAGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(4) -- 20(7.4) 5 - (1)
Digest Temp: 37°C.
Isoschizomers: Aoc I, Axy I, Bse21 I, Bsu36 I, Eco81 I, MstII, OxaNI, SauI. Inactivation Temp: 65°C, 10 min (BRL).
Notes: Mapping Grade (BRL). Not active after 1-2 hr digest (BRL). Ligation problems afer cutting (BRL).
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM KCl.


Dde I
C'TNAG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(3) 100 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1  
Ph(H) 100 50(7.5) 10 1 (2)
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: BstDE I.
Other Compatible Ends: Cvn I.
Inactivation Temp: Not inactivated at 65°C, 10 min (BRL); partially inactivatd at 65& #176;C 15 min (Pro); inactivated at 65°C, 20 min (Amer, NEB, Ph).
Notes: Moderately BAP sensitive. Activity varies with substrate. Star activity (unknown sequence) with high [enzyme] (1000-fold excess), long incubation times (16hrs), high pH, high salt (BRL), DMSO, and >5% glycerol (BRL). We have had BRL enzyme activity after 3 yrs. 2 U/µg for pBR322. Cuts ssDNA slowly (NEB). <10% activity with no NaCl (Pro). Activity decreases after 1 hr digest (BRL). Inhibited by >1 0% glycerol (Amer). Correlation between # of sites & amount of enzyme needed. Cleaves ssDNA slowly (NEB). About 1/3 of sites are religated overnight (BRL). Removed from 2000 Amer catalog.
Methylation Effects: No cuts of 5me-C (BRL). Dcm methylation sensitive at AGCTNAG.
Other Buffer Components:
(1): 1 mM DTE.
(2): Removed from 1997 catalog.


Dpn I
G(me-A)'TC
< TD>-------
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(4) -- 20(7.4) 5 - (2)
NEB(4) -- -- 1 (3)
Pro(B) 50 6(7.5) 6 1  
Roche(A) -- ------- -- 0.5 (1)
Digest Temp: 37°C.
Isoschizomers: All with different cut sites: Bsp143 I, Dpn II, Kzo9 I, Mbo I, Sau3A I, Nde II; FnuE I (methylation differen ce).
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C (Pro); 75°C, 15 min (BRL); 80°C, 20 min (NEB); not inactivated 65°C, 20 min (Amer).
Notes: About 10% (BRL), 25% (Amer), 80% (Pro) of these fragments can be religated. Can be cloned into blunt sites but often hard to cut out. Don't use React 2; activity decreased after 1 hr digest (BRL). 100% activity in PCR buffer (Roche). Activity determined on pBR322 DNA (Pro). Removed from 2000 Amer catalog.
Methylation Effects: Dpn I cuts only me-A DNA (NEB, Pro).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 50 mM KCl.
(3): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


Dpn II
'GATC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(-) 100 -- 10 1 (1)
Digest Temp: 37°C (NEB).
Isoschizomers: Bsp143 I, Dpn I (different cut site), Kzo9 I, Mbo I, Nde II, Sau3A I (different methylation sensitivity).
Other Compatible Ends: BamHI, BclI, Bgl II, DpnII, MboI, Sau3AI, BstYI.
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Notes: Star activity if buffer > pH 6.5 (NEB). After digest, fill-in, and ligation, site can be cut with Cla I, Dpn I, Mbo I, Sau3A I, or Taq I (NEB).
Methylation Effects: Blocked by dam methylation (NEB).
Other Buffer Components:
(1): 50 mM bis Tris-HCl (6.0).


Dra I
TTT'AAA
[NaCl]
Source [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(1) -- 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (2)
Ph(L) -- 10(7.5) 10 1  
Pro(B) 50 6(7.5) 6 1  
Roche(M) 50 10(7.5) 10 - (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Aha III.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C 15 min (Amer, Tak); 65°C 10 min (BRL), 15 min (Pro), 20 min (NEB); 80°C (Amer), 85°C, 30 min (Ph).
Notes: About 33% (BRL) - 80% (NEB, Pro) of these fragments can be religated. Use 4 U/µg for pBR322 (BRL). Unstable when diluted (decreased activity 50%). <10% activity with 100 mM NaCl (Pro). Not active > 3 hrs. Don't use React 4 (BRL). In our hands, little/no activity after 6-7 months. No activity after ethanol precipitation (Tak). Inhibited by >10% glycerol (Amer). Cuts in PCR buffer (Pro, Roche).
Methylation Effects: Cut if internal N6-me-A (Ph).
Other Buffer Components:
(1): 1 mM DTE.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


Dra II
PuG'GNCCPy
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
Roche(L) -- 10(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: EcoO109 I.
Inactivation Temp: at 65°C, 20 min (Amer).
Notes: None.
Methylation Effects: Dcm recognition sequence is CC(A/T)GG. Blocked if 3' meC and if Py=T following GG.
Other Buffer Components:
(1): pH at 37° & 1 mM DTE.


Dra III
CACNNN'GTG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
NEB(3) 100 10(7.9) 10 1 (2)
Roche(H) 100 50(7.5) 10 - (1)
Digest Temp: 37°C (NEB).
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Notes: Star activity: low salt, >5% glycerol, pH>8.0, high [enzyme] (NEB). Removed from 2000 Amer catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): pH at 37°; 1 mM DTE.
(2): 0.1% BSA


Drd I
GACN(4)'NNGTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Methylation Effects: No cuts if meC-G overlaps RE site (NEB).
Other Buff er Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


Dsa I
C'C(Pu)(Py)GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(H) 100 50(7.5) 10 - (1)
Digest Temp: 55°C.
Isoschizomers: Btg I, BstDS I.
Inactivation Temp: Not inactivated at 65°C, 15 min (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE, pH at 37°C.


Dsa V
'CCNGG
Source [NaCl] [Tris](pH)< /TD> [Mg++] [DTT] Other
-- -- ----- -- 0.5 (1)
Digest Temp: 60°C.
Isoschizomers: ScrF I (worse for ligations, Roche).
Inactivation Temp: Not inactivated at 65°C, 15 min (Roche). Deleted from 1997 Roche catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 33 mM tris acetate; 66 mM K acetate; 10 mM Mg acetate; pH 7.9 at 37°C.


Eae I
Py'GGCCPu
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
NEB(1) -- ------- -- 1 (1)
Roche(A) -- ------- -- 0.5 (2)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C (NEB).
Isoschizomers: Cfr I & Cfr14 I.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C 20 min (NEB).
Notes: No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5me-C (Tak), or if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2.
(2): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.


Eag I
C'GGCCG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------ -- -- (1)
NEB(3) 100 50(7.9) 10 1  
Ph(H) 100 50(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: BstZ I, EclX I, Eco52 I, Xma III.
Other Compatible Ends: Bsp120 I, Eae I, Not I.
Inactivation Temp: 65°C, 20 min (Amer, NEB, Ph).
Notes: 5-10 U/µg for pBR322. Activity decreases at lower pH (NEB). Adjust pH between 7.9 to 9.0 at 25°C, 50% decreased activity at pH 7.4 (Ph). After digest, fill-in, and ligation, site can be cut with BsiE I, BsrF I, Cac8 I, Eae I, Eag I, Fse I, Hae III, Hpa II, or Nae I (NEB).
Methylation Effects: Sensitive to 5me-C (Ph, NEB).
Other Buffer Components:
(1): Eag I buffer.


Eam1105 I
GACNNN'NNGTC
Amer(K) -- 20(8.5) 10 1 (1)
Tak(K) -- 20(8.5) 10 1 (1)
Digest Temp: 37&# 176;C.
Isoschizomers:Ahd I, AspE I, EclHK I.
Inactivation Temp: 60°C, 15 min (Tak).
Notes: Star activity if high [glycerol] (Tak), high pH (Tak), or low salt (Tak). Residual activity after ethanol precipitation (Tak).
Methylation Effects: Cuts if 5me-C (Tak).
Other Buffer Components:
(1): 100 mM KCl.


Ear I
5'-CTCTTCN'NNN-3'//3'-GAGAAGNNNN'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(1) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Eam1104 I, Ksp632 I.
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2.


Eci I
5'-GGCGGA(N)11'-3'//3'-CCGCCT(N)9'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 5 0 10(7.9) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: None.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Not recommended for more than 4 hour digest (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 100 µg/ml BSA.


Ecl136 II
GAG'CTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
---- -- ------- -- - (1)
Digest Temp: 37°C.
Isoschizomers: EcoICR I, Psp124B I (different cut site), Sac I (different cut site), Sst I (different cut site).
Other Compatible Ends: Blu nt.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Not in NEB 1998/99 catalog.
Methylation Effects: No cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 66 mM K-acetate, 33 mM tris-acetate (7.9), 10 mM Mg-acetate, 0.1% BSA.


EclHK I
GACN(3)'N(2)GTC
Source [NaCl] [ Tris](pH) [Mg++] [DTT] Other
Pro(E) 100 6(7.5) 6 1  
Digest Temp: 37°C.
Isoschizomers: Ahd I, AspE I, Eam1105 I.
Other Compatible Ends:
Inactivation Temp: 65°C, 15 min (Pro).
Notes: About 10% of these fragments can be religated due to 1 base extension ( Pro).
Methylation Effects: Unknown


EclX I
C'GGCCG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(B) 100 10(8.0) 5 -- (1)
Digest Temp: 37°C.
Isoschizomers: Eag I, Eco52 I, BstZ I, Xma III.
Notes: Not active in PCR buffer (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM 2-me; pH at 37°C.


Eco47 III
AGC'GCT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(3) 100 50(8.0) 1 -  
NEB(O) 100 50(7.5) 10    
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: Afe I, Aor51H I.
Other Compatible Ends: Blunt.
Inactivation Temp: Not inactivated 65°C, 10 min (BRL); needs 100°C for inactivation (Amer); inactivated 65°C, 15 min (Pro), 20 min (NEB).
Notes: About 65% (BRL), 80% (NEB,Pro) of these fragments can be religated. Star activity with high [enzyme] (BRL, NEB). Use 8 U/µg pBR322 (BRL). Activite >5 hrs (BRL). Not active in PCR buffer (Roche). Not in 1998/99 NEB catalog.
Methylation Effects: No cutting of 5' 5me-C (BRL, NEB).
Other Buffer Components:
(1): 1 mM DTE; pH at 37°C.


Eco52 I
C'GGCCG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------- -- -- (1)
Pro(L) 100 10(9.0) 3 -  
Tak(Basal) -- ------- -- --  :
Digest Temp: 37°C.
Isoschizomers: BstZ I, Cf r I, Cfr10 I, Eae I, Eag I, EclX I, Not I, Xma III.
Other Compatible Ends: Not I.
Inactivation Temp: 60°C 15 min (Amer, Tak); 65°C 15 min (Pro).
Notes:Activity determined on Eco RI fragments of lambda DNA (Pro). 50-75% activity in Pro(H) buffer (Pro). Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if any 5me-C (Tak).
Other Buffer Components:
(1): Used to be In Amer(H) buffer; 1996-8 catalog u seEco52 basal buffer +0.1% BSA.


Eco57 I
CTGAAGN((16)'//(14)')
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
---- -- 10(7.5) 10 - (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Has associated methylase activity so can't be recut with enzyme. Not in 1998/99 NEB catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 10 µM S-adenosylmethionine, 0.1% BSA.


Eco72 I
CAC'GTG
Source [NaCl] [Tris](pH)< /B> [Mg++] [DTT] Other
Pro(K) -- 10(7.4) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: BbrP I, PmaC I, Pml I.
Other Compatible Ends: Blunt.
Inactivation Temp: Partially inactivated at 65°C, 15 min (Pro). Removed from 2000 Pro catalog.
Notes: Star activity Pro(B) buff er, sodium or low KCl (Pro).
Methylation Effects: Unknown
Other Buffer Components:
(1): 150 mM KCl.


Eco81 I
CC'TNAGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Aoc I, Axy I, Bse21 I, Bsu36 I, Cvn I, Mst II, Sau I.
Inactivation Temp: 70°C, 15 min (Amer, Tak).
Notes: No ligation after cutting (Amer). No activity after ethanol precipitation(Tak).
Methylation Effects: Unknown.


< A NAME="EcoICRI">EcoICR I
GAG'CTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(B) 50 6(7.5) 6 1 (1)
Digest Temp: 37°C.
Isoschizomers: Ecl136 II, Psp124B I (different cut site), Sac I (different cut site), Sst I (different cut site).
Other Compatible Ends: Blunt.
Notes: Activity determined on EcoR I fragments of lambda DNA (Pro).
Methylation Effects: Unknown
Other Buffer Components: 


EcoN I
CCTNN'NNNNAGG
Source [NaCl] [Tris](pH) [Mg++ ] [DTT] Other
Amer(T) -- ------- -- 0.5 (2)
NEB(4) -- ------- --- 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (Amer, NEB).
Notes: Not more than 50% (Amer, NEB) of these fragments ca n be religated. 1 base extension; add high [ligase] (NEB). Removed from 2000 Amer catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): 33 mM Tris-acetate (7.9); 10 mM Mg-acetate; 66 mM K-acetate; 0.1% BSA.


EcoO65 I
G'GTNACC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1 (1)
Tak(H) 100 50(7.5) 10 1 (2)
Digest Temp: 37°C.
Isoschizomers: Asp AI, BstE II, BstP I, Eca I, Eco91 I, FspA I, PspE I.
Inactivation Temp:< /B> 70°C, 15 min (Amer, Tak).
Notes: Only 60% active in Tak(H) buffer. Star activity in the presence of DMSO (Tak) or in low ionic strength (Tak). Residual activity after ethanol precipitation (Tak).
Methylation Effects: Cuts of 5' C is 5me-C (Tak).
Other Buffer Components:
(1): Add 0.1% BSA.
(2): Add 0.01% BSA.

EcoO109 I
PuG'GNCCPy
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (1)
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Dra II, PssI.
Other Compatible Ends: AsuI, Cfr13 I, Dra II, Sau96 I.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C 10 min (BRL), 20 min (NEB).
Notes: Activity decreases after 1 hr digest (BRL). Use 8U/µ for pBR322 (BRL). No activity after ethanol precipitation (Tak).
Methylation Effects: Blocked by dcm methylation (NEB, Tak).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate; 0.1% BSA.


EcoR I
G'AATTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(3) 100 50(8.0) 10 -  
NEB(-) 50 100(7.5) 10 - (2)
Ph(H) 100 50( 7.5) 10 1  
Pro(H) 50 90(7.5) 10 -  
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Rsr I.
Other Compatible Ends: Apo I, Mun I, Tsp509 I.
Inactivation Temp: Partially resistant at 65°C, 10 min (BRL); inactivated 60°C 15 min (Amer, Tak), 65°C, 15 min (Pro), 20 min (NEB, Ph).
Notes: Cuts at AATT or PuPuATPyPy or other variants with 20 mM Tris-HCl (8.5 Pro), >5% (BRL, NEB) - 12% (Pro) glycerol, with high [glycerol] (Tak); with ethylene glycol (?), if Mn is present (Pro, Tak), high [enzyme] (>25U/µg DNA Pro), 2 mM MgCl2,no (P ro) or low [NaCl] (BRL, Tak), or in low ionic strength (NEB, Tak); 2 mM 2-me may inhibit star activity. Only 50% active in PCR buffer (Roche). Star activity after 18 hrs in PCR buffer, eliminated with 10 mM Mg++ (Pro). Still active after 5 hrs digest (BRL); don't use React 2 buffer (BRL); star activity with React 1 (BRL) & with 1x Ph buffer after 1 hr digest - eliminated with 2x buffer (Ph). No activity after ethanol precipitation (Tak). Cuts ssDNA & possibly RNA of DNA/RNA hybrids. Aggregates on storag e, giving decreased specificity & efficiency. Roche: stable 18 mo. Methylase available. Use 2-5 U/ug for pBR322. pUC19 double digest OK with Sst I, Kpn I, Sma I, BamH I, Pst I, & Xba I. Cleaves oligonucleotide with at least 1 base on each side of sequence (NEB). Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). After digest, fill-in, and ligation, site can be cut with Ase I, Mse I, Tsp509 I, or Xmn I (NEB).
Methylation Effect s: No cuts of 5me-C(Ph, Tak), if 5' (Tak) or 3' 6me-A (Ph, Tak); cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 1 mM DTE.
(2): 0.025% triton X-100.


EcoR II
'CC(A/T)GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(6) 50 50(7.4) 6 1 (1)
Roche(H) 100 50(7.5) 10 -- (2)
Digest Temp: 37°C.
Isoschizomers: Apy I, BsiL I, Bst2U I (different cut site), Mva I (different cleavage site), BstN I (different cut site & insensitive to dcm methylation), Atu I, BstO I.
Inactivation Temp: 65°C, 15 min (Amer), 10 min (BRL).
Notes: Limited stability. One of 3 enzymes that produce >4 base extension. Use >8 U/ug for plasmids (BRL). Not active after 1-2 hrs.
Methylation Effects: Not cut if meA, or 3' 4meC or 5me-C (BRL). DNA from mec+ (C-specific DNA methylase strains) or dcm+ straings are partially resistant to enzyme.
Other Buffer Components:
(1): 50 mM KCl; DTT needs to be aded since it's not in React 6 buffer.
(2): 1 mM DTE .


EcoR V
GAT'ATC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(2) 50 5 0(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1 (2)
Ph(M) 50 10(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roc he(B) 100 10(8.0) 5 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Eco32 I, Ecl136 II, Sac I (different cut site), Sst I (different cut site).
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 10 min (BRL), 15 min (Pro), 20 min (Ph); 70°C 15 min (Amer, Tak); 80°C , 20 min (NEB); not inactivated at 65°C, 15 min (Roche).
Notes: Cuts at beginning of Tc gene of pBR322. Roche: stable 18 mo. Star activity with DMSO (Tak). Not active after 4 hr digest, don't use React 3 (BRL). Residual activity after ethanol precipitation (Tak). Use 2 U/ug for plasmids (BRL). About 65% (BRL) - 80% of these fragments can be religated. Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). 10% ac tivity in PCR buffer (Roche). 50-75% activity in Pro(H) buffer (Pro).
Methylation Effects: Cuts if 3' 5me-C (Ph, BRL, NEB, Tak), no cuts if 5' (NEB, Ph, Tak) or 3' N6-me-A (Tak).
Other Buffer Components:
(1): 1 mM 2-me.
(2): 0.1% BSA.


EcoT14 I
C'C(A/T)(A/T)GG
Source [NaCl] [Tris](pH) [M g++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: BssT I, Eco130 I, Erh I, Sty I.
Inactivation Temp: , 60°C 15 min (Amer, Tak).
Notes: No activi ty after ethanol precipitation (Tak).
Methylation Effects: Unknown


EcoT22 I
ATGCA'T
< /TR>
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Ava III, Mph1103 I, Nsi I, Ppu10 I (different cut site), Zsp2 I.
Other Compatible Ends: AvaIII, Nsi I, Pst I.
Inactivation Temp: 60°C, 15 min (Amer, Tak).
Notes: No activityafter ethanol precipitation (Tak).
Methylation Effects: No cuts if 5me-C (Tak) or 3' N6me-A (Tak ).


Ehe I
GGC'GCC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
NEB(Y) -- ------- -- - (1)
Digest Temp: 37°C.
Isoschizomers: Bbe I (different cut site), Kas I (different cut site), Nar I (different cut site).
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 5 min (Amer), 20 min (NEB).
Notes: 60% (NEB) to 80% (Amer) of these fragments can be religated. Not in 1998/99 NEB catalog. Removed from 2000 Amer catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 66 mM K-acetate, 33 mM Tris-acetate (7.9), 0.1% BSA.


Fau I
TT'CGAA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(SE-B) -- 10(7.6) 10 1  
Digest Temp: 55°C (NEB) .
Isoschizomers:
Inactivation Temp: 65°C, 20 min (NEB).
Notes: RE from SibEnzyme in 1998/99 NEB catalog.
Methylation Effects: Unknown


Fba I
T'GATCA
< TR>
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (1)
Tak(K) -- 20(8.5) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Bcl I, Ksp22 I.
Inactivation Temp: Not inactivated, use ethanol precipitation (Amer, Tak).
Notes: Star activity with high [glycerol] (Tak), high pH (tak), DMSO (Tak), low salt (Tak). No activity after ethanol precipitation (Tak).
Methylation Effects: Not cut if 5' N6me-A (Tak).
Other Buffer Components:
(1): 100 mM KCl.


Fnu4H I
GC'NGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: BsoF I, Fsp4H I, Ita I.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: About 10% of these fragments can be religated (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM tris-acetate (7.9), 10 mM Mg-acetate.


Fok I
5'- GGATG(N)9'-3'//3'-CCTAC(N)13'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1 (3)
NEB(4) -- ------- -- 1 (1)
Pro(B) 50 6(7.5) 6 1  
Roche(M) 50 10(7.5) 10 - (2)
Tak(M) 50 10(7.5) 10 1 (4)
Digest Temp: 37°C.
Isoschizomers: BstF5 I (different cut site)
Other Compatib le Ends:
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 20 min (NEB).
Notes: Don't digest with >5U/µg or >2 hrs (NEB). Ends are difficult to ligate (Pro). Residual activity after ethanol precipitation (Tak). Only 60% activity in Tak(M) buffer and star activity is present (Tak).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-aceta te.
(2): 1 mM DTE.
(3): 0.1% BSA.
(4): 0.01% BSA.

Fse I
GGCCGG'CC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
NEB(4) -- ------- -- 1 (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 30°C (Amer); 37°C (NEB).
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 20 min (NEB).
Notes: 100% activity in NEB(1). Store -80°C; thaw on ice before use; several freeze-thaw cycles do not affect e nzyme activity (Amer). No activity after ethanol precipitation (Tak).
Methylation Effects: Blocked by CpG methylation (NEB). No cuts if either 5' 5me-C (Tak), or if 1st and 3rd 5me-C (Tak).
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM tris-acetate (7.9), 10 mM Mg-acetate, 0.1% BSA.


Fsp I
TGC'GCA
< TD>[Tris](pH)
Source [NaCl] [Mg++] [DTT] Other
Amer(T) -- ------- -- 0.5 (2)
BRL(1) -- 50(8.0) 10 -  
NEB(4) -- ------- -- 0.5 (1)
Tak(T) -- ------- -- 0.5 (3)
Digest Temp: 37°C (NEB).
Isoschizomers: Acc16 I, Aos, I, Avi II,Fdi II, Mst I.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C 10 min (BRL), 20 min (NEB, Amer).
Notes: None.
Methylation Effects: No cuts if middle C is 5me-C (BRL, NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): 33 mM Tris-acetate (7.9); 10 mM Mg-acetate; 66 mM K-acetate.
(3): 33 mM tris-acetate, pH 7.9; 10 mM magnesium acetate; 66 mM potassium acetate; 0.01% BSA.


Hae II
PuGCGC'Py
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 5 0 10(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(4) -- -------- -- 1 (2)
Pro(B) 50 6(7.5) 6 1  
Roche(A) -- ------- -- 0.5 (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C (NEB).
Isoschizomers: Bsp143 I, BstH2 I.
Other Compatible Ends: Bbe I.
Inactivation Temp: 60°C 15 min (Amer, Tak); 65°C 10 min (BRL); 80°C, 20 min (NEB); 85°C 30 min (Ph); not inactivated 65°C, 15 min (Pro), 20 m in (Roche).
Notes: Subset of Hha I. Not as stable in storage as most enzymes. No activity after ethanol precipitation (Tak). About 80% of these fragments can be religated. Highly BAP resistant. Sensitive to DNA contaminants. Stable 18 mo (Roche). Sensitive to desiccation in frost-free freezers. Use 2 U/ug for plasmids (BRL). <10% activity with 150 mM NaCl (Pro). activity decreases after 1 hr digestion (BRL). Correlation between # sites & amount of enzyme needed. Don't use React 1 or 4 (BRL).
Methylation Effects: No cuts if 5' 5me-C (BRL, NEB, Tak), if both C are hemi-methylated (Tak). Cuts slowly if 3; C is 5me-C (Tak).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate; 0.1% BSA.


Hae III
GG'CC
10
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(2) 50 10(7.9) 1  
Ph(M) 50 10(7.5) 10 1  
Pro(C) 50 10(7.9) 10 1  
Roche(M) 50 10(7.5) 10 - (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Blu II, Bse I, Bsh I, BspK I, BspR I, BssC I, BstC I, Bsu1076 I, Bsu1114 I, BsuR I, Clm I, Clt I, FnuD I, Hhg I, Mni I, Mnn II, Ngo II, Pal I, Sfa I, Szo I, Ttn I, Vha I.
Other Compatible Ends: Blunt.
Inactivation Temp: 70°C 15 min (Amer, Tak); 80°C 20 min (NEB); 85°C 30 min (Ph), not inactivated 65°C 10 min (BRL), 15 min (Pro), 20 mi n (Roche).
Notes: Stable up to 70°C. Moderately BAP resistant. Cuts ssDNA 10x slower than dsDNA, same specificity (NEB). May cut RNA of DNA/RNA hybrids at correct site. Use 2 U/µg for p[lasmids (BRL). Inhibited by >200 mM NaCl (Amer). Use 2-5 U/ug of plasmids. Stable 18 months (Roche). Star activity (unknown recognition site) if high [enzyme] (?) or [glycerol] (Tak). Very stable, active after urea treatment. No activity after ethanol precipitation (Tak). Correlation between # sites & amount of enzyme needed. Cuts in PCR buffer (Pro). Activity decreases after 2 hrs digest; don't use React 4 (BRL). pH stability 7.0-8.0 (Amer). Methylase available. 100% activity in PCR buffer (Roche). Need at least 2 nt on each side for >:90% oligonucleotide digestion (NEB).
Methylation Effects: No cuts if 5' 5me-C, OK if 3' 5me-C (BRL, NEB, Ph, Tak); not dsm-methylation sensitive (Pro). Nicks the unmethylated strand if hemi-methylated 5' C (Tak).


Hap II
C'CGG
Digest Temp: 37°C.
Isoschizomers: BsiS I, Hin2 I, Hpa II, Mni II, Mno I, Msp I (different methylation sensitivity), SfaGU I.
Inactivation Temp: 70°C 15 min (Amer, Tak).
Notes: Residual activity after 15 min @ 60°C or after ethanol precipitation (Tak).
Methylation Effects: No cuts if internal meC (Amer, Tak).


Hga I
5'-GACGCN(5)'-3'//3'-CTGCGN(10)'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
Tak(L) -- 10(7.5) 10 1  
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
NEB(1) -- ------- -- 1 (1)
Digest Temp: 37° C.
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Notes: One of 3 enzymes that produce >4 base extension. Cleaves ssDNA at 1% rate of dsDNA (Amer). Don't use >5U/µg or >1 hr digestion (NEB). Removed from 2000 Amer catalog.
Methylation Effects: No cuts if meC-G (NEB).
Other Buffer Components:
(1): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2.


HgiA I
G(T/A)GC(T/A)'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) 100 10(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: Alw21 I, AspH I, Bbv12 I, BsiHKA I.
Inactivation Temp: 65°C (NEB).
Not es: <10% activity with 150 mM NaCl (Pro). Site preference detected. Deleted from 1996-7 NEB catalog.
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).


Hha I
GCG'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (1)
Ph(M) 50 10(7.5) 10 1  
Pro(C) 50 10(7.9) 10 1  
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: AspLE I, Cfo I, Hin6 I (different cut site), HinGU I, HinP1 I (different cut site), HinS I, HspA I (different cut site), FnuD III, Mnn IV, SciN I.
Other Compatible Ends: None.
Inactiva tion Temp: 65°C 10 min (BRL), 15 min (Pro), 20 min (NEB, Ph); 70°C 15 min (Amer, Tak).
Notes: Minor activity (Hha II). Glycerol >5% may alter specificity (BRL). Cleaves ssDNA 50% slower than dsDNA (NEB). Cuts DNA & perhaps RNA of DNA/RNA hybrids at correct site. Use 2 U/ug for plasmids (BRL). Star activity if different conditions (Ph). Star activity increases with [enzyme or glycerol] and presence of DMSO. Methylase available. <10% activity with either 150 mM or no Na Cl (Pro). No activity after ethanol precipitation (Tak). Correlation between # sites & amount of enzyme needed. Cuts in PCR buffer (Pro). Activity decreases after 1 hr digest, not active after 4 hrs (BRL)
Methylation Effects: No cuts if 5' 5me-C (BRL, Ph, NEB, Tak), or 3' 5me-C (Tak).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate; 0.1% BSA.


Hin1 I
R'CGYA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Tak(M) 50 10(7.5) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Acy I, Bbi II, BsaH I, BsaH II, Hin1 I, Hsp92 I, Msp17 I.
Other Compatible Ends: AhaII, AsuI I, Ban III, Bbi II, BstBI, ClaI, Csp45I, HapII, Hin1I, HinPI, HpaII, MaeII, MspI, NarI, NspV, SfuI, TaqI, TthHB8I.
Inactivation Temp: 60°C 15 min (Tak).
Notes: Residual activity after ethanol precipitation (Tak).
Methylation Effects: Cuts GRCGY-5me-C slowly (Tak), GR-5mr-C-GYC not cut (Tak).
Other Buffer Components:
(1): 0.01% BSA.


Hinc II (Hind II)
GTPy'PuAC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(4) -- 20(7.4) 5 - (1)
NE B(3) 100 50(7.9) 10 1 (3)
Ph(KM) -- 10(7.5) 10 1 (1)
Pro(B) 50 6(7.5) 6 1  
Roche(M) 50 10(7.5) 10 - (2)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Chu II, Hind II, HinJC I, Mnn I.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 10 min (BRL), 20 min (NEB, Ph); 70°C 15 min (Amer, Tak).
Notes: Moderately BAP resistant. Sensitive to DNA contaminants, including quick prep DNA. Star activity in the presence of DMSO (Tak). Stable 18 mo (BR L); we had BRL enzyme with decreased activity after 3 yrs. Use 4 U/µg for plasmids (BRL). Stable at room temperature in storage buffer (NEB). At least 65% (BRL) to 80% (Pro) of these fragments can be religated. Activity decreases after 1 hr digest (BRL). Cuts DNA & perhaps RNA of DNA/RNA hybrids. <10% activity with no NaCl (Pro). Star activity with >5% glycerol (BRL). Sensitive to [MgCl2] (Amer). HindII has 100% activity in PCR buffer (Roche). Cuts in PCR buffer (Pro). 50-75% activity in Pro(H) buffer (Pro). No activity after ethanol preciptation (Tak).
Methylation Effects: Not cut if 3' N6-me-A (Ph, Tak) or 3' h5me-C (Ph, Tak); cuts if 3' 5me-C (BRL).
Other Buffer Components:
(1): 50 mM KCl.
(2): 1 mM DTE. Sold as Hind II.
(3): 0.1% BSA. Star activity if overdigested in buffer 4.


Hind III
A'AGCTT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(2) 50 10(7.9) 10 1  
Ph(M) 50 10(7.5) 10 1  
Pro(E) 100 6(7.5) 6 1  
Roche(B) 100 10(8.0) 5 - (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Bbr I, Bpe I, Chu I, Hin173 I, Hinb III, Hinf II, HinJC II, Hsu I, Mki I.
Other Compatible Ends: None.
Inactivation Temp: 65°C, 15 min (Pro), 20 min (NEB); 70°C 15 min (Amer, Tak); 85°C, 30 min (Ph); not inactivated 65°C, 10 min (BRL).
Notes: Activity increases with pH between 7.0 & 8.0. Act ivity varies with substrate. HindII activity with long incubations (Miles). Cleaves oligonucleotides with 10% efficiently in 2 hrs or 75% efficiency in 20 hrs if there are 3 bases on each side of the recognition sequence (NEB). Star activity with Mn ions are present (Amer, Pro, Tak), or in the presence of DMSO (Amer, Tak). Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). pH stability 7.0-9.0 (Amer). Roche: stable 18 mo. We've had Miles enzyme that cut after 5 yrs. Use NH4-acetate & ethanol precipitation before digestion. SV-40 DNA needs 10U/ug. Crude DNA preps cut better with 50 mM MgCl. pUC19 double digests OK with Sph I, Pst I, Sal I, & Xba I. 25-50% activity in Pro(H) buffer (Pro). <10% activity with either 0 or 150 mM NaCl (Pro). Cuts in PCR buffer (Pro). Activity decreases after 2 hrs (BRL). Only 10% activity in PCR buffer (Roche). After digest, fill-in, and ligation, s ite can be cut with Alu I, Bfa I, Cac8 I or Nhe I (NEB). Not active after ethanol precipitation (Tak).
Methylation Effects: No cuts of 5' 6me-A (BRL, Ph) or 5me-C (Ph, BRL) or h5me-C (Ph), cuts if 3' N6-me-A (Ph).
Other Buffer Components:
(1): 1 mM 2-me.


Hinf I
G'ANTC
< TD>[Mg++]
Source [NaCl] [Tris](pH) [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(2) 50 10(7.9) 10 1  
Pro(B) 50 6(7.5) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Dig est Temp: 37°C.
Isoschizomers: FnuA I, Hha II, Nca II, & Nov II.
Other Compatible Ends: None.
Inactivation Temp: 65°C 20 min (Ph), 70°C, 15 min (Amer, Tak); 80°C 20 min (NEB); not inactivated 65°C, 10 min (BRL), 15 min (Pro), 20 min (Roche).
Notes: Hinf II activity has been detected. NaCl needed for optimal activity. Cleaves ssDNA slowly. Unstable if <20µg/ml protein. Star activity if ethylene glycol, high [glyc erol], or substitution of Mn for Mg ions. Active up to 200 mM salt. Not active after ethanol precipitation (Tak). Use 4 U/ug for plasmids (BRL). Not active after 3 hrs (BRL). Don't use React 1 (BRL). Very stable, cleaves under most conditions (Amer). PCR buffer reduces activity 50% (Roche); partially digested in 1 hr, complete in 18 hrs (Pro).
Methylation Effects: Not inhibited by me-C at 3' end as are isoschizomers FnuAI, HhaII, NcaII, & NovII (Tak). Not cut if 5' N6-me-A (BRL, Ph, Tak) or h5me-C (Ph, Tak); cuts if 5me-C (Ph).
Other Buffer Components:
(1): 1 mM DTE.


HinP1 I
G'CGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C (NEB).
Isoschizomers: AspLE I (different cut site), Hha I (but leaves 5' extension), Cfo I (different cut site), Hin6 I (different cut site), HspA I (different cut site).
Other Compatible Ends: AccI of M13 & pUC.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Cleaves ssDNA at 50% rate of dsDNA (NEB). After digest, fill-in, and ligation, site can be cut with BssH II, BstU I, Cac8 I or Hha I( NEB).
Methylation Effects: No cuts if meC-G (NEB).


Hpa I
GTT'AAC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (4)
BRL(4) -- 20(7.4) 5 - (3)
NEB(4) -- ------- -- 1 (1)
Ph(KM) -- 10(7.5) 10 1 (3)
Pro(J) -- 10(7.5) 7 1 (3)
Roche(A) -- ------- -- 0.5 (2)
Tak(K) -- 20(8.5) 10 1 (4)
Digest Temp: 37°C (NEB).
Isoschizomers: Bse II.
Other Compatible Ends: Blunt. Can ligate into Acc I site of M13 & pUC vectors.
Inactivation Temp: 60°C 15 min (Amer, Tak), 85°C 30 min (Ph); not inactivated 65°C 10 min (BRL), 15 min (Pr o), 20 min (NEB).
Notes: About 1/3 (BRL) or about 80% of HpaI fragments can be religated (Pro). Relatively labile, keep digests <1 hr. Sensitive to DNA contaminants & desiccation in frost-free freezer. Use within 3 months. Stable 18 mo (Roche). Moderately BAP resistant. Star activity with >5% glycerol (BRL, NEB), high [glycerol] (Tak), DMSO (Tak), high [enzyme] (NEB), or pH >8.0 (NEB). Activity decreases after 1 hr (BRL). 100% activity in PCR buffer (Roche). Not active af ter ethanol precipitation (Tak). Cuts ssDNA at 50% rate of dsDNA.
Methylation Effects: No cuts if N6-me-A (Ph, BRL, Tak) or h5me-C (Ph, Tak), but OK if 5me-C (Ph, BRL, Tak); no cuts if multiple meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(3): 50 mM KCl.
(4): 100 mM KCl.


Hpa II
C'CGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------ -- - (1)
BRL(8) -- 20(7.4) 10 -  
NEB(1) -- ------- -- 1 (2)
Ph(L) -- 10(7.5) 10 1  
Pro(A) 6 6(7.5) 6 1  
Roche(L) -- 10(7.5) 10 - (3)
Digest Temp: 3 7°C.
Isoschizomers: BsiS I, Bsu1192 I, Bsu1231 I, Hap II, Hin2 I, Mni II, Mno I, Msp I (different methylation sensitivity), SfaGU I.
Other Compatible Ends: Aci I, Aha II, Asu II, Bam III, Ban III, BsiC I, BstB I, Cla I, Csp45 I, Hap II, HinP I, Hsp92 I, Mae II, Nar I, Nsp V, Nsp7524 V, Psp406 I, Sfu I, NunI, TaqI, TthB8I, (some Acc I, Acy I, Bbi II, BsaH I, HgiD I, Hin1 I sites).
Inactivation Temp: 65°C 20 min (Amer, NEB, Ph); not inactivated at 65 76;C 10 min (BRL), 15 min (Pro).
Notes: Can cut ssDNA. Active after 5 hrs. Use 2 U/µg for plasmids. Inhibited by >50 mM KCl (NEB) or by >50 mM salt (Amer). We have had BRL enzyme still active after 3 yrs. Roche: stable 18 mo. <10% activity at 100 mM NaCl (Pro). Methylase available. Correlation between # sites & amount of enzyme needed. Cuts in PCR buffer (Pro). Star activity with React 3 (BRL). After digest, fill-in, and ligation, site can be cut with Aci I, BsaJ I, BstU I, Dsa I, MspA1 I, Sac II (NEB).
Methylation Effects: No cuts if 5me-C (NEB, BRL) vs Msp I which cuts + me-C (Ph). No cuts if 4me-C (BRL).
Other Buffer Components:
(1): Hpa II buffer.
(2): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2; Inhibited by >50 mM KCl.
(3): 1 mM DTE.


Hph I
5'-GGTGAN(8)'-3'//3'-CCACTN(7)'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- ------- -- 0.5 (2)
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: AsuHP I.
Inactivation Temp: 65&# 176;C, 20 min (NEB, Amer).
Notes: More than half of these fragments can be religated (Amer, NEB). May cut at N9//N8 with high A/T content DNA; additional cleavage products with high [enzyme] with phiX174 DNA (NEB). Removed from 2000 Amer catalog.
Methylation Effects: Blocked by dam methylation (NEB); cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): 33 mM Tris-acetate (7.9 ); 10 mM Mg-acetate; 66 mM K-acetate.


Hpy99 I
CG(A/T)CG'
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers:  
Other Compatible Ends: 
Inactivation Temp: 65°C, 20 min (NEB).
Notes:  
Methylation Effects: Unknown.
Other Buffer Components:
(1): 50 mM K-acetate; 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 0.1% BSA.


Hpy188 I
ACN'GT
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers:  
Other Compatible Ends:  
Inactivation Temp: 65°C, 20 min (NEB). < BR> Notes: 60% of DNA fragments can be ligated (NEB).
Methylation Effects: Unknown.
Other Buffer Components:
(1): 50 mM K-acetate; 20 mM Tris-acetate (7.9); 10 mM Mg-acetate.


HpyCH4 III
TCN'GA
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Bst4 C I.
Other Compatible Ends: 
Inactivation Temp: 80°C, 20 min (NEB).
Notes: 60% of DNA fragments can be ligated (NEB).
Methylation Effects: Unknown.
Other Buffer Components:
(1): 50 mM K-acetate; 20 mM Tris-acetate (7.9); 10 mM Mg-acetate.


HpyCH4 IV
ACN'GT
NEB(1) -- ------- 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Mae II.
Other Compatible Ends: 
Inactivation Temp: 65°C, 20 min (NEB).
Notes:  
Methylation Effects: Unknown.
Other Buffer Components:
(1): 10 mM bis tris-propane-HCl (7.0).


HpyCH4 V
TG'CA
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers:  
Other Compatible Ends:  
Inactivation Temp: 65°C, 20 min (NEB).
Notes:
Methylation Effects: Unknown.
Other Buffer Components:
(1): 50 mM K-acetate; 20 mM Tris-acetate (7.9); 10 mM Mg-acetate.


Hsp92 I
GPu'CGPyC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(F) 100 10(8.5) 10 1  
Digest Temp: 37°C (Pro).
Isoschizomers: Acy I, Bbi II, BsaH I, Hin1 I, Hinf II, Msp17 I.
Other Compatible Ends:
Inactivation Temp: 65°C 15 min (Pro).
Methylation Effects: Unknown


Hsp92 II
CATG'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(K) -- 10(7.4) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: Nla III.
Other Compatible Ends: Bbu I, Sph I.
Inactivation Temp: 65°C 15 min (Pro).
Methylation Effects: Unknown
Other Buffer Components:
(1): 150 mM KCl.


I-Ceu I
TAACTATAACGGTCCTAA'GGTAGCGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(-) -- 10(8.6) 10 1 (1)
Digest Temp: 37°C.
Notes: Some sequence degeneracy observed (NEB). Cuts E. coli DNA 7 times (NEB). 1 unit cuts 1 µg of agarose-embedded E. coli DNA in 3 hours at 37°C (NEB).
Methylation Effects: Unknown
Other Bu ffer Components:
(1): 0.1% BSA.


I-PpoI
atgaCTCTCTTAA'GGTAGCcaaa
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB -- 10(8.6) 10 1  
Pro(-) -- ------- 2 1 (1)
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: None.
Inactivation Temp: 65°C, 15 min (Pro).
Notes: Some degeneracy with increase amounts of enzymes. NEB has longer recognition site (in small letters) than Pro (in capital letters) by 4 bp on each side. Activity determined on pGEM plasmid DNA (Pro). Available while supply lasts (1996-7 & 1998/99 NEB catalog).
Methylation Effects: Unknown
Other Buffer Components:
(1): 25mM CHES, 25 mM CAPS, pH 10.0.


I-Sce I
5'-TAGGGATAA'CAGGGTAAT-3' // 3'-ATCCC'TATTGTCCCATTA-5'
< !-- Table 176 Row 02 -->
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(-) -- 10(8.8) 10 1 (1)
Digest Temp: 37°C.
Notes: 1 unit cuts 1 µg of a linearized vector in 1 hours at 37°C (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 0.1% BSA.


Ita I
GC'NGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(H) 100 50(7.5) 10 -- (1)
Digest Temp: 37°C.
Isoschizomers: BsoF I, Fnu4H I.
Inactivation Temp: 65°C, 15 min (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE.


I-Tli I
5'-GGTTCTTTATGCGGACAC'TACGGCTTTATG-3'        
//3'-CCAAGAAATACGCC'TGTGACTGCCGAAATAC-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB 100 5 0(8.6) 10 1  
Digest Temp: 50°C.
Notes: Some degeneracy with excess enzyme. Available while supply lasts (NEB 1998/99 catalog).
Methylation Effects: Unknown


Kas I
G'GCGCC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Bbe I, Ehe I, Nar I, Sfo I (all of these cut at different positions), .
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Site preference noted (NEB). Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). After digest, fill-in, and l igation, site can be cut with BssH II, BstU I, Cac8 I, Hha I (NEB).
Methylation Effects: No cuts if meC-G (NEB).
Other Buffer Components:
(1): 0.1% BSA.


Kpn I
GGTAC'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
BRL(4) -- 20(7.4) 5 - (3)
NEB(1) -- ------- -- 1 (2)
Ph(KM) -- 10(7.5) 10 1 (3)
Pro(J) -- 10(7.5) 7 1 (3)
Roche(L) -- 10(7.5) 10 - (1)
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Asp718 I (different cut site), Nmi I, Acc65 I (different cut site & decreased star activity (Pro).
Other Compatible Ends: None.
Inactivation Temp: 60°C, 15 min (Amer, Tak), 65°C, 10 min (BRL), 85°C, 30 min (Ph); not inactivated 65°C, 20 min (NEB); partially inactivated 65°C, 15 min (Pro).
Notes: Activity varies with DNA, usually need more units than with lambda DNA (usually 5-10 units/ug). Activity determined on Ad-2 DNA (Pro). Highly BAP resistant. Sensitive to DNA contaminants. Not active >2 hrs (BRL). NEB says Atc I is an isoschizomer & not a rare cutter. Ph assay with lambda after hydrolysis with another enzyme (ex. Apa I); NEB uses Ad-2 DNA; IBI uses SV-40 which needs 10 U/ug DNA. Crude DNA preps cut better in 50 mM MgCl2. Star activity with >5% glycerol (BRL, NEB), >12% glycerol (Pro) or >25U/µg (Pro) or Pro(A) buffer (Pro), pH >8.0 (NEB), or DMSO (Tak). No star activity observed with isoschizomer Acc65 I (Pro). Not inhibited by up to 100-fold excess of ssDNA PCR primer containin g the recognition sequence (Biotechn. 15:630, 1993). Cuts in PCR buffer (Pro); only 50% active in PCR buffer (Roche). <10% activity in Pro(H) buffer (Pro). Needs at least 2 nt on each side for oligonucleotide digestion (NEB). No activity after ethanol precipitation (Tak).
Methylation Effects: Not cut if 3' 5me-C (BRL), 3' 4me-C (Ph, Tak), or N6-me-A (Ph, Tak); cuts if any 5me-C (Ph, NEB, Pro, Tak).
Other Buffer Components:
(1): 1 mM DTE.
(2): 10 mM bis tris propane- HCl (7.0); 10 mM MgCl2; 0.1% BSA.
(3): 50 mM KCl.


Kpn2 I
T'CCGGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(4) -- 20(7.4) 5 - (1)
Digest Temp: 55°C.
Isoschizomers: Acc II I, BseA I, BsiM I, Bsp13 I, BspE I, Mro I.
Inactivation Temp: Not inactivated at 65°C, 10 min (BRL).
Notes: Use 4 U/µ for plasmids (BRL).
Methylation Effects: No cuts if 5me-C but cuts 6me-A (BRL).
(1): 50 mM KCl.


Ksp I
CCGC'GC
Other
Source [NaCl] [Tris](pH) [Mg++] [DTT]
Roche(L) -- 10(7.5) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Cfr42 I, Sac II, Sfr303 I, Sst II.
Notes: Rare cutter of mammalian DNA yielding about 100 kb fragments. Not active in PCR buffer (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): pH at 37°


Ksp632 I
CTCTTC(N)
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(A) -- ------- -- 0.5 (1)
Digest Temp: 37°C.
Isoschizomers: Eam1104 I, Ear I.
Methylation Effects: Unknown
Other Buffer C omponents:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.


Mae I
C'TAG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(-) 500 40(8.0) 12 - (1)
Digest Temp: 45°C.
Isoschizomers: Bfa I, Rma I.
Methylation Effects: Unknown
Other Buffer Components:
(1): pH 8.0 at 45°C, 14 mM 2-ME.


Mae II
A'CGT
100(8.8)
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(-) 440 12 - (1)
Digest Temp: 50°C.
Isoschizomers: HpyCH4 IV, Tai I.
Other Compatible Ends: Nar I.
Notes: 20-40% active in Roche(H) buffer. After digest, fill-in, and ligation, site can be cut with Afl III, BstU I, or Mlu I (NEB).
Methylation Effects: Blocked by meC (Roche).
Other Buffer Components:
(1): pH at 50°C, 7 mM 2-ME; 200µg/ml BSA.


Mae III
'GTNAC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(-) 550 40(8.2) 12 - (1)
Digest Temp: 55°C.
Inactivation Temp: 85°C, 30 min (Ph).
Notes: 20-40% activity with Roche(H) buf fer.
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTT; pH at 55°C, 14 mM 2-me.
(2): 14 mM 2-mercaptoethanol.


Mam I
GATNN'NNATC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(H) 100 50(7.5) 10 - (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C 15 min (Roche).
Isoschizomers: BsaB I, Bse8 I, Bsh1365 I, BsrBR I.
Other Compatible Ends: Blunt.
Notes: Star activity if >2.5% glycerol or long incubation at low [NaCl] which change 5'G to an A,C or T. Only 20% active in PCR buffer (Roche).
Methylation Effects: Inhibited by meA in GATC.
Other Buff er Components:
(1): 1 mM DTE; pH at 37°C.


Mbo I
'GATC
< TR>
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (1)
BRL(2) 50 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1  
Pro(C) 50 10(7.9) 10 1  
Tak(K) -- 20(8.5) 10 1 (1)
Digest T emp: 37°C.
Isoschizomers: BsaP I, Bsp143 I, BsrP II, BssG II, BstE II, Cpa I, Dpn I (different cut site), Dpn II, FnuA II, FnuC I, FnuE I, Kzo9 I, Mno III, Mos I, Mth I, Nde II, Nfl I, Pfa I, Sau3A I (different methylation sensitivity).
Other Compatible Ends: BamH I, Bcl I, Bgl II, Bst I, BstY I, Mfl I, Xho II.
Inactivation Temp: 65°C 10 min (BRL), 15 min (Pro), 20 min (NEB); 70°C, 15 min (Amer, Tak).
Notes: About 80% of these fragments can be religated(?). Highly BAP resistant. <10% activity with no NaCl (Pro). Activity decreases after 1 hr digest (BRL). Use >8 U/ug for plasmids (BRL). Don't use with React 1 buffer (BRL). Star activity if high [enzyme], [glycerol] >5%, or pH >8.0. Partially digested in 1 hr, complete in 18 hrs (Pro). No activity after ethanol precipitation (Tak). After digest, fill-in, and ligation, site can be cut with Cla I, Mbo I, Sau3A I, or Taq I (NEB).
Methylation Effects: No cuts if me-A (BRL, Pro, NEB, Tak) or hemi-me-C (Tak); cuts if 5me-C (BRL, Tak), 4me-C (Tak), or hemi-me-C (Tak). DNA from dam+ strains is parially resistant to cutting (BRL).
Other Buffer Components:
(1): 100 mM KCl.


Mbo II
5'-GAAGAN(8)'-3'//3'-CTTCTN(7)'-5'
50
Source [NaCl] [Tris](pH) [Mg++] [DTT]< /B> Other
Amer(L) -- 10(7.5) 10 1  
BRL(1) -- 50(8.0) 10 -  
NEB(2) 100 50(7.9) 10 1  
Pro(B) 6(7.5) 6 1  
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: None.
Inactivation Temp: 65°C 15 min (Pro), 20 min (NEB); 70°C, 15 min (Amer, Tak); partially inactivated at 60°C 15 min (Tak) or 65°C, 10 min (BRL).
Notes: Fairly BAP resi stant. About 10% (BRL), 20% (Pro), 50% (NEB) of fragments can be religated. Sensitive to DNA contaminants. Use 4 U/ug for plasmids. Activity decreases after 3 hr digest (BRL); active only 15 min (NEB). Use phenol & high [ligase] after cutting (NEB). No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 3' N6-me-A (BRL, Tak). Blocked by dam methylation (NEB, Pro). Cuts if 5' N6-meA or either 5me-C (Tak).



Mfe I
C'AATTG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Mun I.
Inactivation Temp: 65°C, 20 min (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM tris-acetate(7.9), 10 mM Mg-acetate.


Mfl I
Pu'GATCPy
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: BstX2 I, BstY I, Xho II.
Inactivation Temp: Not inactivated, phenol extact (Amer, Tak).
Notes: Residual activity after ethanol precipitation (Tak).
Methylation Effects: Blocked by dam methylation of internl A (Tak) or 4me-C o r 5me-C at fifth position (Tak). Slowly cuts DNA if 5' N6-meA (Tak).


Mlu I
A'CGCGT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(3) 100 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1  
Ph(H) 100 50(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: Asc I, BssH II; some Dsa I sites.
Inactivation Temp: Partially inactivated at 65°C, 10 min (BRL); inactivated 6 5°C 20 min (NEB), 85°C, 30 min (Ph); not heat inactivated, use ethanol precipitation (Amer, Tak).
Notes: >5% glycerol inhibits activity (BRL). <10% activity with no NaCl or with 150 mM NaCl (Pro). Active after 5 hr digest. <5% active in PCR buffer (Roche). 100% activity in Pro(H) buffer (Pro). Not active after ethanol precipitation (Tak). After digest, fill-in, and ligation, site can be cut with BssH II, BstU I, cac8 I, Hha I (NEB). Two nt on each side of an oligon ucleotide result in 25% digestion in 2 hrs and 50% digestion in 20 hrs (NEB).
Methylation Effects: No cuts if 5' 5me-C (Ph, Tak), no cuts if meC-G (NEB); cuts if m6-A (Ph, Tak).
Other Buffer Components:
(1): 1 mM DTE.


MluN I
TGG'CCA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(A) -- ------- -- 0.5 (1)
Digest Temp: 37°C.
Isoschizomers: Bal I, Msc I.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 15 min (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37& #176;C.


Mly I
GAGTCN(5)'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: N.BstNB 1 (cuts only 1 strand of DNA), Ple I, Sch I.
< B>Other Compatible Ends:
None.
Inactivation Temp: 65°C, 20 min (NEB).
Notes:  
Methylation Effects: Unknown.
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM Tris-acetate (7.9), 10 mM Mg-acetate; 100 µg/ml BSA.
Mnl I
5'-CCTCN(7)'-3'//3'-GGAGN(6)'-5'
Source [NaCl] [Tris](p H) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
NEB(2) 50 10(7.9) 10 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (Amer, NEB).
Notes: About 80% of these fragments can be religated (Amer). Moderately BAP resistant. Relatively unstable (IBI), use within 6 months. Cleaves ssDNA at 50% rate of dsDNA (Amer). Removed from 2000 Amer catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 0.1% BSA.


Mro I
T'CCGGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(A) -- ------- -- 0.5 (1)
Digest Temp: 37°C.
Isoschizomers: Acc III (inhibited by dam methylation), BseA I, BsiM I, BspE I, BspM II, Kpn2 I.
Other Compatible Ends: AccIII, BspMII, Cfr10I, XcyI, XmaI.
Inactivation Temp: 100°C (Amer).
Notes: None.
Methylation Effects: Not inhibited by dam methylation.
Other Buffer Components:
(1): 33 mM tris-acetate, 66 mM K-acetate, 10 mM Mg-acetate, pH 7.9 at 37°C.


MscI
TGG'CCA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(2) 50 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Bal I, MluN I.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 10 min (BRL), 20 min (NEB, Amer).
Notes: About 1/3 of ends can be religated overnight (BRL).
Meth ylation Effects: Blocked by dcm methylation (BRL, NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


Mse I
T'TAA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(1) -- 50(8.0) 10 -  
NEB(2) 50 10(7.9) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Tru1 I, Tru9 I.
Inactivation Temp: 65°C, 20 min (NEB); partially inactivated at 65°C, 10 min (BRL).
Notes: About 80% of these fragments can be religated. 0 or 50 mM NaCl is OK, 50 & 75% activity with 100 & 150 mM NaCl, respectively. Use 2 U/µ for plasmids (BRL). Stable at 37°C for 10 hr digest (NEB).
Methylation Effects: Not sensitive to m5-CG or m5-CNG (NEB).
Other Buffer Components:
(1): 0.1% BSA.


Msl I
CAYNN'NNRTG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 20 min (NEB).
Methylation Effects: Unknown


Msp I
C'CGG
So urce [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(1) -- 50(8.0) 10 -  
NEB(2) 50 10(7.9) 1 0 1  
Ph(L) -- 10(7.5) 10 1  
Pro(B) 50 6(7.5) 6 1  
Roche(L) -- 10(7.5) 10 - (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: BsiS I, Bsu1192 I, Bsi1231 I, Hap II (different methylation sensitivity), Hin2 I, Hpa II (different methylation sensitivity), Mni II, Mno I, SfaGU I.
Other Compatible Ends: Aci I, Aha II, Asu II, Ban III, Bbi I, BsiC I, BsiX I, Bsp106 I, BstB I, BspD I, Cla I, Csp45 I, HgiD I, HinP I, Hsp92 I, Mae II, Nar I, Nsp V, Nsp7524 V, Psp1406 I, Sfu I, TaqI, TthHB8 I; some Acc I, Acy I, Bbi II, BsaH I, HgiD I, Hin1 I sites.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C 10 min (BRL), 15 min (Amer, Pro), 20 min (NEB, Ph).
Notes: Stable 18 mo (Roche). Can cut ssDNA. Cuts DNA & perhaps RNA of DNA/RNA hybrids. Use 0.5 U/ug for plasmids. Methylase available. Correlation between # sites & amount of enzyme needed. Cuts in PCR buffer (Pro). Not active after 2 hr digest (BRL). After digest, fill-in, and ligation, site can be cut with Aci I, BsaJ I, Bst U I, Dsa I, MspA I, Sac II (NEB). Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5' 5me-C (BRL, Ph, Tak) or if both C's are hemi-methylated (Tak), OK if 3' 5me-C (BRL, NEB) or any 4me-C (Ph); no methylation inhibition (Amer).
Other Buffer Components:
(1): 1 mM DTE.


MspA1 I
C(A/C)G'C(G/T)G
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Pro(C) 50 10(7.9) 10 1  
Digest Temp: 37°C (NEB).
Isoschizomers: NspB II.
Other Compatible E nds: Blunt.
Inactivation Temp: 65°C, 15 min (Pro), 20 min (NEB).
Notes: Star activity with >10U/µg (Pro), or Pro(B) buffer (Pro). Store at -70°C (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 mM tris-acetate(7.9), 10 mM Mg-acetate, 50 mM K-acetate, 0.1% BSA.


Mun I
C'AATTG
Sour ce [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(1) -- 50(8.0) 10 -  
Roche(M) 50 10(7.5) 10 -- (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: FnuD II, Tha I, Acc II, Mfe I.
Other Compatible Ends: EcoR I.
Inactivation Temp: 70°C 15 min (Tak). Partial resistance at 65°C, 10 min (BRL).
Notes: Star activity with excess enzyme >20U/µg (Roche), high [glycerol] (Tak), or low ionic strength (Tak). Residual activity after ethanol precipitation (Tak). After digest, fill-in, and ligation, site can be cut with Ase I, Mse I, Tsp509 I (NEB).
Methylation Effects: No cuts if 3' N6me-A (Tak).
Other Buffer Components:
(1): 1 mM DTE.


Mva I
CC'(A/T)GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20 (8.5) 10 1 (1)
Roche(H) 100 50(7.5) 10 -- (2)
Tak(K) -- 20(8.5) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: Apy I, Bst2U I, BstN I, EcoR II (different cut site & methylation sensitivity), BstO I, PspG I.
Inactivation Temp: 60°C, 1 5 min (Amer, Tak).
Notes: No ligation after cutting (Amer). Fill in with Klenow before ligation. Residual activity after ethanol precipitation (Tak).
Methylation Effects: Cuts if 5me-C (Tak); no cits if 4me-C (Tak) or N6-me-A (Tak).
Other Buffer Components:
(1): 100 mM KCl.
(2): 1 mM DTE.


Mvn I
CG'CG
Source [N aCl] [Tris](pH) [Mg++] [DTT] Other
Roche(M) 50 10(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: Acc II, Bsh1236 I, BstU II, Tha I.
Other Compatible Ends: Blunt.
Notes: 30% activity in PCR buffer (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE.


Mwo I
GCN(5)'NNGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(-) 150 50(7.9) 10 1 (1)
Digest Temp: 60 6;C (NEB).
Isoschizomers: BspW I.
Inactivation Temp: Not inactivated at 65°C, 20 min (NEB).
Notes: 10% activity at 37°C (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 0.1% BSA.


Nae I
GCC'GGC
Source [NaCl] [Tris](pH) [Mg++]< /B> [DTT] Other
Amer(L) -- 10(7.5) 10 1  
NEB(1) -- ------- -- 1 (2)
Pro(A) 6 6(7.5) 6 1  
Roc he(A) -- ------- -- 0.5 (1)
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: MroN I (different cut site), NgoA IV (different cut site), NgoM I = NgoM IV (different cut sites).
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C 15 min (Amer, Tak); 65°C 15 min (Pro), 20 min (NE B).
Notes: Very sensitive to 1° & 2° structure and recognition site; site preference noted (NEB, Pro). Pro sells "Turbo Nae I" (with separate buffer to avoid this problem). Inhibited by > 100 mM NaCl (Amer). More than half to 80% (NEB), 90% (Pro) of these fragments can be religated. Not active in PCR buffer (Roche). Activity determined on Ad-2 DNA which has a slow cut site (Pro). No activity after ethanol precipitation (Tak).
Methylation Effects: Sensitive to 5me- CG (NEB, Tak).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2.


Nar I
GG'CGCC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------ -- - (1)
BRL(1) -- 50(8.0) 10 -  
NEB(1) -- ------- -- 1 (2)
Ph(L) -- 10(7.5) 10 1  
Pro(G) -- 50(8.2) 5 -  
Roche(A) -- ------- -- 0.5 (3)
Digest Temp: 37°C.
Isoschizomers: Bbe I (different cut site), Ehe I (different cut site), Kas I (different cut site), Nda I, Nun I.
Other Compatible Ends: Aci I, Acy I, Aha II, Asu II, Ban III, Bbi II, BsaH I, Bs iC I, BsiX I, Bsp106 I, BspD I, BstB I, Cla I, Csp45 I, Hap II, HgiD I, Hin1 I, HinP1 I, Hpa II, Hsp92 I, Mae II, Msp I, Nsp V, Nsp7524 V, Psp1406 I, Sfu I, Taq I, TthHB8 I; some Acc I sites.
Inactivation Temp: 65°C, 10 min (BRL, Pro, Amer), 20 min (NEB, Ph).
Notes: Use 2 U/ug for plasmids (BRL). Correlation between # sites & amount of enzyme needed. Stable 24 hrs, 37°C (BRL). Rare cutter. Activity determined on Ad-2 DNA (Pro). Not inhibited by up to 100-fold molar ex cess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). Strong site preference of Nar I (NEB, Pro) is not seen with Ehe I (NEB); site in bacteriophage lambda (Ph) and pBR322 (NEB) is highly resistant. Cleavage rate varies with different constructs (BRL). After digest, fill-in, and ligation, site can be cut with Asc I, BssH II, BstU I, cac8 I, Hha I (NEB). Removed from 2000 Amer catalog.
Methylation Effects: No cuts if 5' 5me-C (BRL, Ph), 3' 4me-C or 3' 5me-C (Ph ), or meC-G (NEB).; OK if 3' 5me-C (BRL).
Other Buffer Components:
(1): Nar I buffer.
(2): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2.
(3): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.


N.BstNB I
5'-GAGTCNNNN'N-3'//3'-CTCAGNNNNN-5'
Source [NaCl] [Tris](pH) [Mg++ ] [DTT] Other
NEB(-) -- 10(7.5) 10 1 (1)
Digest Temp: 55°C. Less than 10% activity at 37°C (NEB).
Isoschizomers: Mly I, Ple I, Sch I (all 3 which cut both strands of DNA).
Inactivation Temp: 80°C, 20 min (NEB).
Methylation Effects: Unknown
Notes: Cuts only one strand of DN A. 10 units nick 1 µg of supercoiled DNA to nicked circular DNA in 1 hr, 55 °C (NEB).
Other Buffer Components:
(1): 150 mM KCl.


Nci I
CC'(C/G)GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(8) -- 20(7.4) 10 -  
NEB(4) -- ------- -- 1 (2)
Pro(B) 50 6(7.5) 6 1  
Roche(L) -- 10(7.5) 10 - (1)
Digest Temp : 37°C (NEB).
Isoschizomers: Bcn I, Cau II.
Other Compatible Ends:
Inactivation Temp: 65°C 15 min (Amer, Pro), 20 min (NEB); partially inactivated 10 min (BRL).
Notes: 30% (Pro) to 50% (NEB) of these fragments can be religated. Try high [ligase] (NEB). May generate 3'-PO4 & 5'OH ends. Will cut 3'-PO4 ends (Pro). Use 4 U/µg for plasmids (BRL). Inhibited by >10% glycerol (Amer). Star activity with Pro(A) buffer, <50 mM salt (Pro). Kinase before ligation. Stable 18 mo (Roche). About 30% of these fragments can be religated (Pro). <10% activity at 100 mM NaCl (Pro). Active after 5 hr digest (BRL).
Methylation Effects: No cuts if 3'C is 4me-C or 5me-C, OK if 5' C is 5me-C (BRL).
Other Buffer Components:
(1): 1 mM DTE.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate; 0.1% BSA.


Nco I
C'CATGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------- -- - (3)
BRL(3) 100 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (2)
Ph(H) 100 50(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
T ak(Basal) -- ------- -- -- (3)
Digest Temp: 37°C.
Isoschizomers: Bsp19 I.
Other Compatible Ends: BspH I, Rca I, RspX I; some Afl III sites.
Inactivation Temp: 65°C, 10 min (BRL), 15 min (Pro), 20 min (Ph, NEB); 70°C, 15 min (Amer, Tak).
Notes: Activity decreases after 3 hr digest (BRL). <10% active at 50 mM NaCl (Pro). Don't use with BRL React 1 or 2 buffe rs (BRL). 100% activity in Pro(H) buffer (Pro). Site contains ATG so may be used for fusing initiation site to expression vectors (Ph). Star activity in 1x but not 2x buffer (Ph), high [glycerol] (Tak), or DMSO (Tak). Only 50% active in PCR buffer (Roche). Residual activity after ethanol precipitation (Tak). After digest, fill-in, and ligation, site can be cut with Nla III or Nsi I (NEB). Four nt on each side result in 50% digestion in 2 hrs and 75% digestion of an oligonucleotide after 20 hrs (NEB). Methylation Effects: No cuts if 5' 5me-C (BRL, Ph, Tak), or 5' 4me-C (Ph, Tak); cuts if N6-me-A (Ph, Tak).
Other Buffer Components:
(1): 1 mM DTE.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(3): NcoI basal buffer.


Nde I
CA'TATG
Source [NaCl] [Tris](pH) [Mg++]< /B> [DTT] Other
Amer(T) -- ------- -- 0.5 (3)
BRL(2) 50 50(8.0) 10 -  
NEB(4) -- ------- -- 1 (2)
P h(M) 50 10(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37& #176;C.
Isoschizomers: FauND I.
Other Compatible Ends: Ase I, Asn I, Bfa I, Csp6 I, Mae I, Mse I, Tru9 I, Vsp I.
Inactivation Temp: 65°C, 15 min (Pro), 20 min (Amer, NEB, Ph); 70°C 15 min (Tak); not inactivated 65°C, 10 min (BRL).
Notes: Sensitive to DNA contaminants (quick preps, NEB, Ph). Use 4 U/ug for plasmids (BRL). <10% activity with 50 mM NaCl (Pro). Don't use with React 3 buffer (BRL). Activity decreases after 1 hr (BRL); 37°C half-life = 15 min (NEB). Not active after ethanol precipitation (Tak). Activity significantly inhibited by 2M excess of ssDNA PCR primer containing the recognition sequence. Remove primers before digestion (Biotechn. 15:630, 1993). Star activity with >10% glycerol (Pro). Add 7 nt to an oligonucleotide for 75% digestion in 2 hrs or >90% digestion in 20 hrs (NEB). Removed from 2000 Amer catalog.
Methylation Effects: Cuts if 5me-C (Ph, Tak).
Other Buffer Components:
(1): 1 mM DTE.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(3):33 mM Tris-acetate (7.9); 10 mM Mg-acetate; 66 mM K-acetate.


Nde II
'GATC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(10) 150 100(7.6) 10 1 (1)
Pro(D) 150 6(7.9) 6 1  
Roche(-) 150 100(7.6) 10 1 (2)
Digest Temp: 37°C.
Isoschizomers: Sau3A I (not methylation sensitive), Bsp143 I, Dpn I (different cut site), Dpn II, K zo9 I, Mbo I (needs me-A).
Other Compatible Ends: BamHI, Bcl I, Bgl II, BstY I, Mfl I, Xha II.
Inactivation Temp: 65°C, 10 min (BRL), 15 min (Pro).
Notes: Use >8 U/ug for plasmids (BRL). Active after 5 hr digest (BRL). Neighboring site sensitive.
Methylation Effects: No cuts if me-A (BRL, Pro). Not sensitive to m5-CG or m5-CNG.
Other Buffer Components:
(1): Add DTT to buffer since it is not in React 10 buffer.
(2): pH at 37°C.


NgoA IV
G'CCGGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(9) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: N ae I (different cut site), MroN I, NgoM I = NgoM IV.
Inactivation Temp: Not inactivated at 65°C, 10 min (BRL).
Notes: Active after 5 hr digest (BRL). Use 4 U/µg for plasmids (BRL). No site preference like NaeI & NgoMI (BRL).
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM K-acetate; 20mM Tris-acetate; 10 mM Mg-acetate; pH 7.9.


NgoM I = NgoM IV
G'CCGGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other NEB(4) -- ------- -- 1 (1) Pro(-) -- ------- -- 1 (2) Digest Temp: 37°C.
Isoschizomers: MroN I, Nae I (different cut site), NgoA IV.
Other Compatible Ends:
Inactivation Temp: 65°C 15 min (Pro); 80°C, 20 min (NEB).
Notes: Activity determined on Ad-2 DNA (Pro). Star activity with Pro(A), Pro(B), and Pro(C) buffers (Pro). After digest, fill-in, and ligation, site can be cut with BsiE I, BsrF I, Cac8 I, Eae I, Eag I, Hae III, Hpa II, NgoM I (NEB). NgoM I has been named MgoM IV (NEB 1998/99 catalog).
Methylation Effects: No cuts if meC-G in MgoM IV (NEB).
Other Buffer Components:
(1): 50 mM K-acetate; 20mM Tris-acetate; 10 mM Mg-acetate; pH 7.9.
(2): 25mM tris-acetate (7.8), 100 mM K-acetate, 10 mM Mg-acetate, 1 mM DTT.


Nhe I
G'CTAGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(4) -- 20(7.4) 5 - (1)
NEB(2) 50 10(7.9) 10 1 (3)
Ph(M) 50 10(7.5) 10 1  
Pro(B) 50 6(7.5) 6 1  
Roche(M) 50 10(7.5) 10 - (2)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C (NEB).
Isoschizomers : None.
Other Compatible Ends: Avr II, Bln I, Spe I, Xba I.
Inactivation Temp: 65°C 15 min (Pro), 20 min (NEB, Ph); 70°C, 15 min (Amer); not inactivated 65°C, 10 min (BRL).
Notes: 1 site in lambda & pBR322 (Tc gene). Activity determined on EcoR I fragments of lambda (Pro). Use 2 U/µg for plasmids (BRL). Inhibited 5-6-fold in 50-100 mM NaCl (BRL); >100 mM NaCl (NEB); >5% glycerol (BRL). Star activity with high [glycerol] (Tak), al kaline pH (Tak), in the presence of DMSO (Tak), or in low ionic strength (Tak). Activity decreases after 1 hr digest (BRL). Rare cutter. Cleaves only 10% of oligonucleotides with 3 bases on each side of sequence in 2 hrs, or 50% in 20 hrs (NEB). Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). No activity after ethanol precipittion (Tak). After digest, fill-in, and ligation, site can be cut with Alu I, Bfa I, Cac8 I, Nhe I (NEB). 10 -25% activity in Pro(H) buffer (Pro).
Methylation Effects: No cuts if 3' 5me-C (Ph, Tak); no cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 50 mM KCl.
(2): 1 mM DTE.
(3): 0.1% BSA.


Nla III
'CATG
Other
Source [NaCl] [Tris](pH) [Mg++] [DTT]
Amer(T) -- ------- -- 0.5 (2)
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C (Amer).
Isoschizomers: Hsp92 II.
Other Compatible Ends: Sph I.
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Notes: Digests m ore than 3 hrs not recommended (NEB). Inhibited by NaCl & KCl, but not (NH4)2SO4 (NEB). Store at -70°C for long-term (NEB, Amer); -70°C half-life is 6 mo (NEB). Removed from 2000 Amer catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate, 0.1% BSA.
(2): 33 mM Tris-acetate (7.9); 10 mM Mg-acetate; 66 mM K-acetate.


Nla IV
GGN'NCC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: PspN4 I.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Notes: NaCl & KCl inhibit activity (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate, 0.1% BSA.


Not I
GC'GGCCGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1 (2)
BRL(3) 100 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1 (3)
Ph(H) 100 50(7.5) 20 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 10(7.5) 10 1 (4)
Digest Temp: 37°C.
Isoschizomers: CciN I.
Other Compatible Ends: Bsp120 I, BstZ I, Eae I, EclX I, Eco52 I, Xma III.
Inactivation Temp: 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB, Ph); 70°C 15 min (Tak); not inactivated, phenol extract (Amer).
Notes: Rare cutter. Poor cutting if <8 bases on either side of site (NEB). Activity decreases after 1 hr (BRL). Activity determined on Ad-2 DNA (Pro). Digest with 5-fold excess enzyme for supercoiled DNA (NEB). HaeIII methylase protects Not I but not SfiI sites (NEB). Not active in PCR buffer, & activity not restored with addition of NaCl (Roche). 100% activity in Pro(H) buffer (Pro). After digest, fill-in, and ligation, site can be cut with Aci I, BsiE I, BsoF I, BsrF I, Cac8 I, Eae I, Eag I, Fse I, Hae III, Hpa II, Nae I (NEB). At least 8 nt on each side of an oligonucleoti de containing a Not I sequence are digested at 90% efficiency over 20 hrs, but only 25% efficiency after 2 hrs (NEB). Residual activity after ethanol precipitation (Tak). Only 20% activity in Tak(H) buffer.
Methylation Effects: Not cuts if 2nd or 3rd C is 5me-C (Ph, BRL, Tak), no cuts if meC-G (NEB); cuts if 5' (Tak) or 3' 5me-C(Ph).
Other Buffer Components:
(1): 1 mM DTE.
(2): 0.1% BSA & 0.01% triton X-100.
(3): 0.1% BSA.
(4): 0.01% BSA & 0.01% Triton X- 100.

Nru I
TCG'CGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------- -- - (2)
BRL(7) 50 50(8.0) 10 - (3)
NEB(-) -- 50(7.7) 10 - (1)
Pro(K) -- 10(7.4) 10 - (4)
Roche(B) 100 10(8.0) 5 - (5)
Tak(Basal) -- ------- -- -- (6)
Digest Temp: 37°C.
Isoschizomers: Bsp68 I, Spo I.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C, 15 min (Amer, Tak), 65°C 15 min (Pro), 20 min (NEB); 85°C, 30 min (Ph); partially inactivated at 65°C, 10 min (BRL).
Notes: 20% (NEB, Pro) to 33% (BRL) of these fragments can be religated. Use 2 U/µg for plasmids (BRL). Activity decreases after 1 hr (B RL). Rare cutter. 75% activity in PCR buffer (Roche). Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 6me-A (BRL, Tak), Dam methylation sensitive (NEB, Pro); no cuts if meC-G (NEB), cuts if 3' C is 5me-C (Tak).
Other Buffer Components:
(1): 100 mM KCl.
(2): NruI basal buffer + 0.1% BSA.
(3): 50 mM KCl.
(4): 150 mM KCl.
(5): 1 mM 2-me.
(6): NruI basal buffer.

Nsi I ATGCA'T
< /TR>
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(-) 100 10(8.4) 10 1  
BRL(3) 100 50(8.0) 10 -  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: Ava III, EcoT22 I, Mph1103 I, Ppu10 I (different cut site), Zsp2 I.
Other Compatible Ends: Pst I.
Inactivation Temp: Not inactivat ed at 65°C, 10 min (BRL); inactivated 65°C, 15 min (Amer), 20 min (Pro, NEB).
Notes: Not active after 1-2 hr. Correlation between # sites & amount of enzyme needed. Don't use React 2 buffer (BRL). 10% of oligonucleotides with 3 adjacent nt on each side are cut in 2 hrs, 90% in 20 hrs; addition of 13 nt to the 3' end increases the 2 hr digestion to >90% efficiency (NEB). 100% activity in Pro(H) buffer (Pro).
Methylation Effects: Unknown
Other Buffer Components :
(1): 1 mM DTE.


Nsp I = Nsp7524 I
PuCATG'Py
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (1)
BR L(1) -- 50(8.0) 10 -  
NEB(2) 50 10(7.9) 10 1 (3)
Roche(M) 50 10(7.5) 10 - (2)
Digest Temp: 37°C (Amer, NEB), 50°C.
Isoschizomers: NspH I.
Other Compatible Ends: BspH I, Nla III, NspH I, Nsp7524 I, Rs pX I, Sph I.
Inactivation Temp: 60°C, 15 min (Amer); 65°C, 10 min (BRL), 20 min (NEB).
Notes: Use 2 U/µg for plasmids (BRL). Add 0.15% triton X-100 to enzyme dilutions (NEB). Removed from 2000 Amer catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 100 mM KCl, 0.1% BSA, 0.01% triton X-100.
(2): 1 mM DTE (sold as Nsp7524 I).
(3): 0.1% BSA, 0.15% Troton X-100.


Nsp V = Nsp75 24 V
TT'CGAA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
BRL(1) -- 50(8.0) 10 - & nbsp;
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Asu II, Bpu14 I, BsiC I, Bsp119 I, BstB I, Cbi I, Sfu I, Csp45 I, Lsp I, Fsp I, Nsp7524 V.
Other Compatible Ends: Cfo I, Hha I.
Inactivation Temp: 70°C, 15 min (Amer, Tak); partially inactivated 60°C 15 min (Tak), 65°C, 10 min (BRL).
Notes: Activity decreases a fter 1 hr (BRL). Amersham sell as Nsp7524 V. About 2/3 of these fragments can be religated (BRL). Residual activity after ethanol precipitation (Tak).
Methylation Effects: Unknown


NspB II
C(A/C)G'C(T/G)G
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
Digest Temp: 37°C (Amer).
Isoschizomers: MspA1 I.
Notes: Activity decreases at >25 mM NaCl (Amer). About 80% of these fragments can be religated (Amer). Removed from 2000 Amer catalog.
Methylation Effects: Unknown


Pac I
TTAAT'TAA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(1) -- ------- -- 1 (1)
Digest Temp: 37°C (NEB).
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Notes: PacI containing oligonucleotides with 1-2 adjacent nt on each si de are not cut in 2 hrs, but are 25% cut with 1 nt and >90% cut with 2 nt after 20 hrs (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2, 0.1% BSA.


PaeR7 I
C'TCGAG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C (NEB).
Isoschizomers: Sfr274 I, Tli I, Xho I.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes: Star activity, unknown recognition site. CTCTCGAG is resistant to enzyme (NEB). After digest, fill-in, and ligation, site can be cut with BsiE I, Mbo I, Pvu I, Taq I (NEB).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2.


Pci I
A'CATGT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(SEB 3-O) 100 50(7.6) 10 1  
Digest Temp: 50°C.
Isoschizomers: BspLU11 I.
Inactivation Temp: 65°C, 20 min (NEB).
Methylation Effects: Unknown
Notes: From SibEnzyme, sold by NEB.


PflF I
GACN'NNGTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Tth111 I.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: About 10% of the fragments can be religated.
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate; 0.1% BSA.


PflM I
CCANNNN'NTGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
NEB(3) 100 50(7.9) 10 1 (1)
Digest Temp: 37°C.
Isoschizomers: AccB7 I (which is not methylation sensitive), Esp1396 I, Van91 I.
Inactivation Temp: 65°C, 20 min (Amer, NEB).
Notes: Site preference observed (NEB). About 75% of these fragments can be religated (Amer).
Methylation Effects:< /B> Blocked by dcm methylation (NEB).
Other Buffer Components:
(1): 0.1% BSA.


PinA I
A'CCGGT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(4) -- 20(7.4) 5 - (1)
Roche(B) 100 10(8.0) 5 - (2)
Digest Temp: 50°C.
Isoschizomers: Age I.
Inactivation Temp: 65°C, 10 min (BRL), 15 min (Roche).
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM KCl.
(2): 1 mM 2-me.


PI-Psp I
TGGCAAACAGCTATTAT'GGGTATT ATGGGT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(-) -- 10(8.6) 10 1 (1)
Digest Temp: 65°C (NEB).
Notes: Some sequence degeneracy (NEB). 1 unit cleaves 1 µg of agarose-embedded E. coli DNA in 3 hours at 55°C (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 150 mM KCl, 0.1% BSA.


PI-Sce I (VDE)
ATCTATGTCGGGTGC/GGAGAAAGAGGTAATGAAATGGCA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(-) -- 10(8.6) 10 1 (1)
Digest Temp: 37°C.
Notes: Available while supply lasts (1996-7 & 1998/99 NEB catalog). 1 unit cleaves 1 µg of a linearized vector in 3 hr at 37°C (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 100 mM KCl, 25 µg/ml BSA.


PI-Tli I
GGTTCTTT ATGCGGACAC'TGACGGCTTTATG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB 100 50(8.6) 10 1  
Digest Temp: 50°C.
Notes: More than half of these fragments can be religated (NEB). Some sequen ce degeneracy (NEB). Available while supply lasts (1996-7 NEB catalog).
Methylation Effects: Unknown


Ple I
5'-GAGTCN(4)'-3'//3'-CTCAGN(5)'-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- --- ---- -- 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Isoschizomers: Mly I, N.BstNB I (cuts only 1 strand of DNA), Sch I.
Notes: About 20% of these fragments can be religated (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.


PmaC I
CAC'GTG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: BbrP I, Eco72 I, Pml I.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C, 15 min (Amer, Tak).
Notes: No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if internal 5me-C (Tak).


Pme I
GTTT'AAAC
Source [NaCl] [Tri s](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C (NEB).
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Good for PFGE. Use 4 U/µg for plasmids (NEB). Oligonucleotides with 2 adjacent nt on each side of the Pme I site are uncut after 2 hrs and 50% digested after 20 hrs; those with 6 nt on the 5' side and 10 nt on the 3' side are 75% cut after 2 hrs and >90 cut after 20 hrs (NEB).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1):50 mM K-acetate; 20mM Tris-acetate; 10 mM Mg-acetate; pH 7.9; 0.1% BSA.


Pml I
CAC'GTG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(1) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: BbrP I, Eco72 I, PmaC I.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Looses activity after 6 mo (NEB). Store at -70°C for extended periods (NEB).
Methylation Effects: No cuts if meC-G (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate, 0.1% BSA.


Ppu10 I
A'ATGCAT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Ot her
NEB(Y) -- ------- -- - (1)
Digest Temp: 37°C.
Isoschizomers: EcoT22 I (different cut site), Mph1103 I (different cut site), Nsi I (different cut site), Zsp2 I.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes: After digest, fill-in, and ligation, site can be cut with Cac8 I, Nla III, Nsi I, Nsp I, Ppu 10 I, Sph I (NEB). Not in 2000-1 NEB catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 66 mM K-acetate, 33 mM tris-acetate (7.9), 10 mM Mg-acetate, 0.1% BSA.


PpuM I
PuG'G(A/T)CCPy
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- ------- -- 0.5 (2)
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Psp5 II.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB, Amer).
Notes: Removed from 2000 Amer catalog.
Methylation Effect s: Blocked by dcm methylation (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): 33 mM Tris-acetate (7.9); 10 mM Mg-acetate; 66 mM K-acetate.


PshA I
GACNN'NNGTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other< /TD>
Amer(K) -- 20(8.5) 10 1 (1)
NEB(4) -- ------- -- 1 (2)
Tak(K) -- 20(8.5) 10 1 (1)
Digest Temp: 37°C.
Other Compatible Ends: Blunt.
Inactivation Temp: 60° C, 15 min (Amer, Tak); 65°C, 20 min (NEB).
Notes: Incubate at 25°C if digest time >1 hr (NEB). Not active after ethanol precipitation (Tak).
Methylation Effects: No cuts if multiple meC-G overlaps RE site (NEB), if 5' 5me-C (Tak); cuts if 3' 5me-C (Tak).
Other Buffer Components:
(1): 100 mM KCl.
(2): 50 mM K-acetate, 20 mM tris-acetate (7.9), 10 mM Mg-acetate, 0.1% BSA.


PshB I
AT'TAAT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Tak(Basal) -- ------- -- -- (1)
Digest Temp: 37°C.
Isoschizomers: Ase I, Asn I, Vsp I.
Other Compatible Ends: None.
Inactivatio n Temp: 70°C, 15 min (Tak).
Notes: Not active after ethanol precipitation (Tak).
Methylation Effects: Unknown.
Other Buffer Components:
(1): PshB I basal buffer.


Psi I
TTA'TAA
< !-- Table 134 Row 02 -->
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(SEB 1) -- 10(7.6) 10 1  
Digest Temp: 37°C.
Isoschizomers: None.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: About 50% of these fragments can be religated (NEB).
Methylation Effects: Unknown
Notes:From SibEnzyme, sold by NEB. 50% of cut DNA can be ligated (NEB).


Psp1406 I
AA'CGTT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(L) -- 10(7.5) 10 1  
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Acl I.
Other Compatible Ends: Aci I, Acy I, Aha II, Asu II, Ban III, Bbi II, BsaH I, BsiC I, BsiX I, Bsp106 I, BspD I, BstB I, Cla I, Csp45 I, Fnu4H I, Hap II, HgiD I, Hin1 I, HinP I, HinP1 I, Hpa II, Hsp92 I, Mae II, Mlu I, Msp I, Nar I, Nsp V, Nsp7524 V, Nun II, Psp1406 I, Sfu I; some Acc I sites.
Inactivation Temp: 60°CC 15 min (Tak); 65°C, 15 min (Roche), 20 min (NEB).
Notes: After diges t, fill-in, and ligation, site can be cut with Afl III, BstU I, Mlu I (NEB). Star activity in presence of DMSA (Tak). Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5meC-G (NEB, Tak).
Other Buffer Components:
(1): 66 mM K-acetate, 33 mM tris-acetate (7.9), 10 mM Mg-acetate, 0.1% BSA.


PspG I
'CC(A/T)GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 75°C. 10% activity at 37°C (NEB). Two fold increased activity at 85°C (NEB).
Isoschizomers: Apy I, BstN I, BstO I, EcoR II, Mva I.
Inactivation Temp: Not heat inctiv ated (NEB).
Notes: Stable at 85°C; 2 hr half-life at 95°C.
Methylation Effects: Blocked by dcm methylation (NEB).


PspOM I
G'GGCCC
< TD>--
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(SEB5Y) ------- -- 1 (1)
Digest Temp: 37°C.
Isoschizomers: Apa I, Bsp120 I.
Inactivation Temp: 65°C, 20 min (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 66 mM K-acetate; 33 mM Tris-acetate (7.9); 10 mM Mg-acetate (Sib enzyme buffer SE 5 Y).


Pst I
CTGCA'G
100
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(3) 50(7.9) 10 1  
Ph(M) 50 10(7.5) 10 1  
Pro(H) 50 90(7.5) 10 -  
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Bbi I, Bce170 I, Bsu1247 I, EcoT22 I, Noc I, Pma I, SalP I, Sfl I, Xma II, Xor I.
Other Compatible Ends: Nsi I, EcoT22 I, Sse8387 I; some alw21 I, AspH I, Bmy I, BsiHKA I, Nsp1286 I, HgiA I sites
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 15 min (Pro); 80°C, 20 min (NEB); 85°C 30 min (Ph); not inactivated 65°C 15 min (Roche); partially inactivated 65°C, 10 min (BRL).
Notes: Decreasing activity with increasing [NaCl] (no cuts if >300 mM NaCl). Star activity with high [enzyme] (>25U/µg Pro), DMSO (Tak), or >5% (BRL) or 12% (Pro) glycerol or high [glycerol] (Tak). pH stability = 7.5-8.5, and sensitive to >3% glycerol (Amer). Poor cutting in crude DNA preps: precipitate with NH4-acetate & ethanol, better cuttin g of such DNA with 50 mM MgCl2. Sensitive to DNA contaminants. Stable 18 mo (Roche). Needs at least 2 nt on the 5' side and 12 on the 3' side for 90% digestion of a Pst _-containing oligonucleotide; very poor cutting of oligonucleotides with up to 4 bases on each side of sequence (NEB). Not active after ethanol precipitation (Tak). Methylase available. Highly BAP resistant. 90% activity in PCR buffer (Roche); partially digested in 1 hr, complete in 18 hrs (Pro). Use 4 U/ug for plasmids (BRL). pUC19 d ouble digests OK with BamH I, EcoR I & Xba I; partially digested with Sph I & Hind III; not digested with Sal I. Not active after 1-2 hours (BRL).
Methylation Effects: No cuts if 5' 5me-C or if N6-me-A (BRL, Ph, Tak).
Other Buffer Components:
(1): 1 mM DTE.


Pvu I
CGAT'CG
< TR>
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (3)
BRL(7) 50 50(8.0) 10 - (2)
NEB(3) 100 50(7.9) 10 1 (4)
Ph(H) 100 50(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(K) -- 20(8.5) 10 1 (5)
Digest Tem p: 37°C.
Isoschizomers: BspC I, Nbl I, Ple19 I, Rsh I, Rsp I, Xni I, Xor II.
Other Compatible Ends: Pac I.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 80°C, 20 min (NEB); 85°C, 30 min (Ph); not inactivated 65°C, 10 min (BRL), 15 min (Pro, Roche).
Notes: Optimal religation if in dam- E. coli strain (NEB, Pro). Activity decreases after 3 hr digest (BRL). Highly BAP resistant. Use 2 U/ug for plasmids (BRL). Stable 18 mo. (Roche). Inhibited by >10% glycerol. <10% activity at 50 mM NaCl (Pro). 5-fold decreased activity with 10 mM Tris-HCl (7.5), 150 mM NaCl, 10 mM MgCl2, 10 mM 2-Me (Ph). Ph assays w/lambda after cutting with EcoR I. 1 site in pBR322, 3 in lambda. 50 mM KCl enhances digestion of supercoiled DNA (NEB). Not active afterethanol precipitation (Tak). Only 25% digest efficiency after 20 hrs for an oligonucleotide containing a Pvu I site with 2 adjacent nt on each side; 10% efficiency with 3 nt on e ach side (NEB). <5% active in PCR buffer (Roche). 80% active in Tak(H) buffer.
Methylation Effects: Cuts if N6-me-A (Ph, BRL, Pro, Tak), but not cut if 3' 4me-C (Ph, Tak) or 3' 5me-C (Ph, BRL, Tak); no cuts if meC-G (NEB). E. coli strains with adenine methylase cut at slower rates (NEB). Ligation problems if N6-me-A residues (Pro) located near ends (NEB).
Other Buffer Components:
(1): 1 mM DTE.
(2): 50 mM KCl.
(3): 100 mM KCl, 0.1% BSA.
(4): 0.1% BSA.
(5): 100 mM KCl & 0.01% BSA.


Pvu II
CAG'CTG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(6) 50 50(7.4) 6 - (2)
NEB(2) 50 10(7.9) 10 1  
Ph(M) 50 10(7.5) 10 1  
Pro(B) 50 6(7.5) 6 1  
Roche(M) 50 10(7.5) 10 - (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C 15 min (Pro), 20 min (Ph); partially inactivated at 65°C, 10 min (BRL); not inactivated 65°C, 15 min (Roche), 20 min (NEB); not inactivated, phenol extract (Amer, Tak).
Notes: Moderately BAP resistant. Star activity: >5% (BRL, NEB) or >12% (Pro) glycerol, high [glycerol] (Tak), low salt (IBI,NEB), high [salt], high [enzyme] (NEB) (>25U/ug (Pro)), pH >8.0 (NEB), excess time (IBI), or in the presence of DMSO (Tak). Stable 18 mo (Roche); we have NEB enzyme that was active after 3 yrs. Residual activity after ethanol precipitation (Tak). Use 2 U/ug for plasmids (BRL). Not active af ter 4 hr digest. 100% active in PCR buffer (Roche). Cuts in PCR buffer (Pro). pH stability = 7.5 - 9.0 (Amer). 65% (BRL) to 95% (NEB) of these fragments can be religated (BRL).
Methylation Effects: No cuts if 5' me-C (NEB), or 3' 4me-C (BRL, Tak) or 3' 5me-C (Pro, BRL, Ph, Tak).
Other Buffer Components:
(1): 1 mM DTE.
(2): 50 mM KCl.


Rca I
T'CATGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(4) -- 20(7.4) 5 - (1)
Roche(B) 100 10(8.0) 5 - (2)
Digest Temp: 37°C.
Isoschizomers: BspH I, RspX I. Inactivation Temp: 65°C, 10 min (BRL), 15' (Roche).
Notes: Active 1 hr digest (BRL). Use 4 U/ug for plasmids (BRL).
Methylation Effects: No cuts if 3' N6-meA (BRL). No cuts if dam methylated (BRL).
Other Buffer Components:
(1): 50 mM KCl.
(2): 1 mM 2-me.


Rma I
C'TAG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Isoschizomers: Mae I.
Digest Temp: 55°C.
Isoschizomers: BfaI & MaeI.
Notes: Deleted from 1996-7 NEB catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 20 mM Tris-acetate (7 .9); 10 mM Mg-acetate; 50 mM K-acetate.


Rsa I
GT'AC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
B RL(1) -- 50(8.0) 10 -  
NEB(1) -- ------- -- 1 (2)
Ph(L) -- 10(7.5) 10 1  
Pro(C) 50 10(7.9) 10 1  
Roche(L) -- 10(7.5) 10 - (1)
Digest Temp: 37°C (NEB).
Isoschizomers: Afa I, Csp6 I (different cut site).
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 10 min (BRL), 15 min (Amer, Pro), 20 min (NEB, Ph).
Notes: Use Sca I to reduce # cuts (AGT/ACT). Stable 18 months (Roche). Cleaves ssDNA slowly (NEB). Use 4 U/ug for plasmids (BRL). Not active after 2 hours. Inhibited by >10% glycerol. Cuts in PCR buffer (Pro, Roche). About 65% of these fragments can be religated (BRL).
Methylation Effects: No cuts if N6-me-A or 4me-C (Ph); cuts if 5me-C (Ph), no cuts if multiple meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 1 mM DTE.
(2): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2.


Rsr II
CG'G(AT)CCG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(5) -- 10(8.2) 8 1 (2)
NEB(4) -- ------- -- 1 (1)
Roche(L)< /B> -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Cpo I, Csp I.
Inactivation Temp: 65°C, 10 min (BRL), 20 min (NEB).
Notes: Rare cutter. To digest DNA in agarose plugs, use 10-12 U/µg for 4 hrs (Roche). About 1/3 of Rsr II fragments can be religated (BRL).
Methylation Effects: No cuts if meC-G (NEB).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): Add 1 mM DTT since it's not part of React 5 buffer. Needs DTT for long digestions. 1 unit cuts 1 µg lambda in 18 hrs.


Sac I
GAGCT'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(L) -- 10(7.5) 10 1  
NEB(1) -- ------- -- 1 (2)
Ph(L) -- 10(7.5) 10 1  
Pro(J) -- 10(7.5) 7 1 (3)
Roche(A) -- ------- -- 0.5 (1)
Tak(L) -- 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Ecl136 II (different cut site), EcoICR I (different cut site), Sst I, Ecl136 I, Psp124B I.
Other Compatible Ends: Aat II; some BsaO I, BsiE I, Mcr I sites.
Inactivation Temp: 60°C, 15 min (Amer); 65°C 15 min (Pro), 20 min (NEB, Ph), .
Notes: Highly BAP resistant. Sensitive to DNA contaminants. Stable 18 mo (Roche). Activity determined on lambda DNA after HdIII (Ph), or EcoR I digest (Pro). 10% digestion if only 1 base on either side of site in oligonucleotides (NEB). 100% active in PCR buffer (Roche). 25-50% activity in Pro(H) buffer (Pro). Inhibited by >10 mM salt (NEB); plasmid preps with residual salt don't cut well (NEB). Star activity with high [glycerol] (Tak) or in presence of DMSO (Tak). No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5' 5me-C (Ph, Tak); cuts if N6-me-A(Ph, Tak), 3' 5me-C (Ph, Tak), or if meC-G overlaps RE site (NEB).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 10 mM bis tris propane-HCl (7.0); 10 mM MgCl2, 0.1% BSA.
(3): 50 mM KCl.

Sac II
CCGC'GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- --- -- 0.5 (2)
NEB(4) -- ------- -- 1 (1)
Ph(L) -- 10(7.5) 10 1  
Pro(C) 50 10(7.9) 10 1  
Tak(T) -- ------- -- 0.5 (3)
Digest Temp: 37°C.
Isoschizomers: Ksp I, Sst II.
Other Compatible Ends: Cfa I, Cfr42 I, Hha I, Nsp IV, Sfr303 I; some BsaO I, BsiE I, & McrI sites.
Inactivation Temp: 65°C 15 min (Pro), 20 min (Amer, NEB, Ph); 70°C, 15 min (Tak).
Notes: Highly BAP resistant. Rare cutter. Residual activity after 60 °C 15 min or ethanol precipitation (Tak). Sensitive to DNA contaminants. <10% activity at 50 mM NaCl (Pro); inhibited by > 10 mM NaCl, site preferences noted (NEB, Ph). Pro(A) buffer gives incomplete digestion of supercoiled DNA (Pro). Some lambda & ph iX174 sites cleaved at slower rate than others (NEB). Activity determined on Ad-2 DNA (Pro). Cuts in PCR buffer (Pro). 100% activity in Pro(H) buffer (Pro). Needs at least 3 bases on each side of sequence for 90% efficient digestion of oligonucleotides over 20 hrs; 50% cut after 2 hrs (NEB). Removed from 2000 Amer catalog.
Methylation Effects: No cuts if 5' 5me-C (Ph), or if meC-G (NEB, Tak).
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K- acetate.
(2): 33 mM tris-acetate (7.9), 10 mM Mg-acetate, 66 mM K-acetate, 0.1% BSA.
(3): 33 mM tris-acetate, pH 7.9; 10 mM magnesium acetate; 66 mM potassium acetate; 0.01% BSA.


Sal I
G'TCGAC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(10) 150 100(7.6) 10 -  
NEB(-) 150 10(7.9) 10 1 (2)
Ph(H) 100 10(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: HgiC III, HgiD II, Nop I, Rhe I, Rhp I, Rrh I, R ro I, Rtr I, SalG I, Xam I.
Other Compatible Ends: ApaL I, Ccr I, PaeR7 I, Xho I; some Ava I sites.
Inactivation Temp: 60°C, 15 min (Amer, Tak), 65°C, 15 min (Pro), 20 min (NEB, Ph); not inactivated at 65°C, 10 min (BRL).
Notes: Stable 18 mo (Roche). Star activity with different buffers (Ph), ethylene glycol, > 5% (BRL) or 12% (Pro) glycerol or high [glycerol] (Tak), >25U enzyme/µg of DNA (Pro), or DMSO (NEB, Tak). Inhibited by [NaCl] <100 mM. <10% active at 100 mM NaCl (Pro). 25-50% activity in Pro(H) buffer (Pro). Activity decreases after 2 hr digest (BRL). Ph: assays activity with lambda after EcoR I digestion; cuts pBR322 at 10% the activity of lambda; use 8 (BRL) - 10 (NEB) U/µg for supercoiled plasmids, 0.5 U/µg linear plasmids. Not active in PCR buffer, and activity restored to only 40% with adjustment to 100 mM NaCl (Roche); poor digest in PCR buffer, increased activity with 6 mM Mg++ ions (Pro). Not active afte r ethanol precipitation (Tak). Cuts DNA & perhaps RNA of DNA/RNA hybrids. Subset of Taq I sites. After digest, fill-in, and ligation, site can be cut with BsiE I, Mbo I, Pvu I, Taq I (NEB). 2 nt on 5' side and 22 nt on 3' side result in 10% digestion over 2 hrs or 50% digestion over 20 hrs for a Sal I-containing oligonucleotides (NEB).
Methylation Effects: No cuts if N6-me-A (BRL, Ph, Tak or 5' 5me-C (BRL, Ph, Tak) or if meC-G (NEB); cuts if 3' 5me-C (Ph, Tak).
Other Buffer Component s:
(1): 1 mM DTE.
(2): 0.1% BSA.


Sap I
GCTCTTCN((1)'//N(4))'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- -- -- 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM tris-acetate, 10 mM Mg-acetate, pH 7.9.


Sau3A I
'GATC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(4) -- 20(7.4) 5 - (2)
NEB(-) 100 -- 10 1 (3)
Ph(KM) -- 10(7.5) 10 1 (2)
Pro(B) 50 6(7.5) 6 1  
Roche(A) -- ------- -- 0.5 (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Bsp143 I, Mbo I (doesn' t cut N6-me-A), Dpn I (different cut site), Dpn II (different methylation sensitivity), Kzo9 I, Nde II.
Other Compatible Ends: BamH I, Bcl I, Bgl II, BsiQ I, Bst I, BstY I, Mbo I, Mfl I, Xho II.
Inactivation Temp: 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB); 70°C, 15 min (Amer, Tak); 85°C, 30 min (Ph).
Notes: Star activity if >7.5% glycerol (BRL) or high [glycerol] (Tak), low [salt] (BRL), high pH (BRL), DMSO (Tak), or high [enzyme]. Reported star activity = GAGC or CATC. 60% inhibited with 5 mM 2-Me. Stable 18 mo (Roche). Use 2 U/µg for plasmids (BRL). Buffers with BME can reduce activity 50% (NEB). 30-fold excess enzyme leaves nicks in dsDNA. Affected by adjacent sequence. Not active after ethanol precipitation (Tak). Not active after 2 hr digest (?). Correlation between # sites and amount of enzyme needed. 100% active in PCR buffer (Roche). After digest, fill-in, and ligation, site can be cut with Cla I, Dpn II, Mbo I, Sau3A I, Taq I (NE B).
Methylation Effects: No cuts if 4me-C (Ph, Tak), if meC-G overlaps site (NEB), if 5me-C (Ph, BRL), or h5me-C (Ph, Tak); cut if N6-me-A (BRL, Ph, Pro), but slowly (Tak). Nicks unmethylated strand if hemi-methylated 5me-C (Tak).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 50 mM KCl.
(3): 10 mM bis tris propane-HCl (7.0), 0.1% BSA.


Sau96 I
G'GNC C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- --- -- 0.5 (1)
NEB(4) -- ------- -- 1 (2)
Pro(C) 50 10(7.9) 10 1  
Roche(A) -- ------- -- 0.5 (3)
Digest Temp: 37°C.
Isoschizomers: AspS9 I, Asu I, Cfr13 I, Nsp IV.
Other Compatible Ends:
Inactivation Temp: 80°C, 20 min (NEB); not inactivated at 65°C 15 min (Pro), 20 min ( Amer, BRL, Roche).
Notes:Stable 18 months (Roche). Some lambda sites are not cut by Sau96 but are by Asu I (not methylation). Active after 5 hr digest (BRL). Use 8 U/µg for supercoiled plasmids & 2 U/µg linear plasmids.
Methylation Effects: Blocked by dcm methylation (NEB, Pro).
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C, 0.1% BSA.
(2): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(3): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.


Sbf I
TT'CGAA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(SE-Y) -- -- ------- 1 (1)
Digest Temp: 37 °C (NEB).
Isoschizomers: Sse8387 I.
Inactivation Temp: Not inactivated at 65°C, 20 min (NEB).
Notes: RE from SibEnzyme in 1998/99 NEB catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 66 mM K-acetate, 33 mM tris-acetate (7.9), 10 mM Mg-acetate.


Sca I
AGT'ACT
1
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(6) 50 50(7.4) 6 - (1)
NEB(-) 100 10(7.4) 10 1< /TD>  
Ph(KH) -- 10(8.0) 10 1 (3)
Pro(K) -- 10(7.4) 10 - (4)
Roche(H) 100 50(7.5) 10 - (2)
Tak(H) 100 50(7.5) 10  
Digest Temp: 37°C.
Isoschizomers: Acc113 I, Eco255 I.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C 15, min (Amer, Tak); 65°C, 10 min (BRL), 15 min (Pro); 80°C, 20 min (NEB); 85°C, 30 min (Ph); not inactivated 65°C, 15 min (Roche).
Notes: Unique amp site pBR322. Rsa recognizes internal sequence of ScaI, so ScaI is useful to reduce the # of Rsa sites. More than 6 5% of these fragments can be religated overnight (BRL). Use 4U/µg for plasmids (BRL). Star activity with over digestion, low [salt] (BRL, Tak), >5% glycerol (BRL), high pH (Tak), (pH 8.5) (BRL), Mn vs Mg ions (Tak), high [enzyme] (NEB), or Pro(B) or Multi-core buffer (Pro). Had quick prep DNA that was not cut by ScaI, but purified DNA cut fine. <10% activity at 100 mM NaCl (Pro). Not active >1 hour. <5% active in PCR buffer (Roche). Activity determined on Ad-2 DNA (Pro). Not active af ter ethanol precipitation (Tak). Use at least 3 nt on each side of the Sca I site for 75% digestion of oligonucleotides (NEB).
Methylation Effects: Cuts if 5me-C (Ph).
Other Buffer Components:
(1): 50 mM KCl.
(2): 1 mM DTE.
(3): 100 mM KCl.
(4): 150 KCl.


ScrF I
CC'NGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Roche(B) 100 10(8.0) 5 - (2)
Digest Temp: 37°C.
Isoschizomers: BssK I (different cut site), Dsa V (/CCNGG = better for ligations), MspR9 I.
In activation Temp: 65°C, 15 min (Amer), 20 min (NEB).
Notes: Little to no ligation after cutting due to single base overhang (NEB). <10% active at 50 mM NaCl (Pro).
Methylation Effects: Use E. coli strains deficient for cytosine methylase (blocked by dcm methylation NEB). No cuts if 3' me-C; 5' me-C OK.
Other Buffer Components:
(1): 20 mM Tris-acetate (7.9); 10 mM Mg-acetate; 50 mM K-acetate.
(2): 1 mM 2-me.


SexA I
A'CC(A/T)GGT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 (2)
Roche(B) 100 10(8.0) 5 - (1)
Digest Temp: 37°C (Roche, NEB).
Inactivation Temp: 65°C, 15 min (Roche), 20 min (NEB).
Notes: None.
Methylation Effects: Blocked by dcm methylation (NEB).
Other Buffer Components:
(1): 1 mM 2-me.
(2): 0.1% BSA.


SfaN I
5'-GCATCN(5)-3'//3'-CGTAGN(9)-5'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).


Sfc I
C'TPuPyAG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: Use at least 1 U/µg (NEB); active only 1 hr at 37° C (NEB). 25% activity at 25°C good for plasmids over a 4-16 hour digestion (NEB). 0.1 U digests 1 µg DNA in 16 hrs at 25°C (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM K-acetate; 20mM Tris-acetate; 10 mM Mg-acetate; pH 7.9, 0.1% BSA.


Sfi I
GGCCN(4)'NGGCC
Digest Temp: 50°C (Amer, BRL, NEB, Pro <10% activity at 37°C - Pro, NEB); 37°C (Ph).
Isoschizomers: None.
Other Compatible Ends: None.
Inactivation Temp: 65°C 15 min (Pro), 85°C, 30 min (Ph); not inactivated 65°C, 10 min (BRL), 20 min (NEB, Amer, Roche).
Notes: Good for cutting large fragments of chromosomes. Activity decreases after 1 hr digest (BRL). Star activity in the presenceof Mn ions (Tak) or DMSO (Tak). Subset of BglI sites. Thaw on ice for 2 hrs before use; can be freeze/thawed 5 times, aliquot first (BRL). Activity determined on Ad-2 DNA (Pro). 50-75% activity in Pro(H) buffer (Pro). HaeIII methylase protects Not I but not SfiI sites (NEB). More than 65% of these fragments can be religated overnight (BRL).
Methylation Effects: Not cut if 1st C is 4me-C (Tak), or if 2nd C is 5me-C (Ph, Tak), or if 3' C is 5me-C (Tak); cuts GG(meC)CNGG(meC)C (Ph, Tak) or 3' 5me-C (Ph); sensitive tooverlapping dcmmethylation (Pro).
Other Buffer Components:
(1): 1 mM DTE; pH at 37°C.
(2): 0.1% BSA.


Sfo I
GGC'GCC
Source [NaCl] [T ris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB(2) 50 10(7.9) 10 1 (2)
Ph(M) 50 10(7.5) 10 1  
Pro(B) 50 6(7.5) 6 1  
Roche(M) 50 10(7.5) 10 - (1)
Tak(M) 50 10(7.5) 10 1  
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C (NEB).
Isoschizomers: Asu II, Bpu14 I, BsiC I, Bsp119 I, Cbi I, Ehe I, Lsp I, Kas I Nar I.
Inactivation Temperature: 65°C, 20 min (NEB).
Compatible Ends: Blunt.
Methylation Effects: Unknown


Sfu I
TT'CGAA
Source [NaCl] [Tr is](pH) [Mg++] [DTT] Other
Roche(H) 100 50(7.5) 10 - (1)
Digest Temp: 37°C (Roche).
Isoschizomers: Asu II, Bpu14 I, BsiC I, Bsp119 I, BstB I, Cbi I, Csp45 I, Lsp I, Nsp V.
Compatible Ends:
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE; pH at 37°C.


Sgf I
GCGAT'CGC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(C) 50 10(7.9) 10 1  
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: Pvu I.
Inactivation Temp: Partially inactivated at 65°C, 15 min (Pro).
Notes: Activity determined on Ad-2 DNA (Pro). Star activity with >12% glycerol or >25U/µg of DNA (Pro). Rare cutter. Inactivated at -70°C (Pro).
Methylation Effects: Not dam methylation sensitive, but sensitive to CpG methylation (Pro).


SgrA I
C(A/G)'CCGG(T/C)G
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (2)
Roche(A) -- ------- -- 0.5 (1)
Digest Temp: 37°C.
Other Com patible Ends: Cfr10 I, Xma I, Mro I, Acc III, BspM II.
Inactivation Temp: 65°C, 20 min (NEB), not inactivated at 65°C, 15 min (Roche).
Notes: Rare cutter. Star activity if low ionic strength (NEB), high [enzyme] (NEB), glycerol >5% (NEB), or pH >8.0 (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 33 mM tris acetate, 66 mM K acetate, 10 mM Mg acetate, pH 7.9 at 37°C.
(2): 50 mM K-acetate, 20 mM Tr is-acetate (7.9), 10 mM Mg-acetate.


Sin I
G'G(A/T)CC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(A) 6 6(7.5) 6 1  
Digest Temp: 37°C.
Isoschizomers: Ava II, Bme18 I, Eco47 I, HgiE I.
Other Compatible Ends:
Inactivation Temp: 65°C 15 min (Pro).
Notes: <10% activity in 50 mM NaCl (Pro).
Methylation Effects: Unknown


Sma I
CCC'GGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- ------- -- 0.5 (2)
BRL(4) -- 20(7.4) 5 - (1)
NEB(4) -- ------- -- 1 (3)
Ph(KL) -- 10(8.0) 10 1 (4)
Pro(J) -- 10(7.5) 7 1 (1)
Roche(A) -- ------- -- 0.5 (2)
Tak(T) -- ------- -- 0.5 (5)
Digest Temp: 25°C (Roche, Pro, NEB); 30°C (Amer, BRL , Ph). 50% activity at 37°C (BRL).
Isoschizomers: Cfr9 I (different cut site), PspA I (different cut site), PspAL I, Xma I (different cut site), XmaC I (different cut site), Xcy I.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 15 min (Pro), 20 min (Ph, NEB); partially inactivated 65°C, 10 min (BRL).
Notes: KCl absolute requirement (BRL). 30°C has 2x the activity of 37°C (Pro). 37°C hal f-life is 15 min (NEB). Moderately BAP resistant. Sensitive to DNA contamination. Residual activity after ethanol precipitation (Tak). More than half of these fragments can be religated (Pro). Ph: units assayed with lambda after Hd III hydrolysis. Stable 18 mo. (Roche). pUC19 double digests OK with Sst I, BamH I, & Xba I; not digested with Kpn I. <10% activity in Pro(H) buffer (Pro). Needs at least 3 bases on each side of the site for >90% digestion of oligonucleotides (NEB). 15 min half-life at 3 7°C (NEB); activity decreases after 1 hr (BRL). Activity slightly inhibited by 10-fold excess and significantly inhibited by 100-fold excess of ssDNA PCR primer containing the recognition sequence. Remove these primers before digestion (Biotechn. 15:630, 1993). 100% active in PCR buffer (Roche). Cuts in PCR buffer (Pro). More than 65% (BRL), 90% (Pro) of these fragments can be religated.
Methylation Effects: No cuts if 3' 5me-C (BRL) or 3' 4me-C (Ph), 5' 4me-C or 5' 5me-C or internal 4m e-C (Ph), no cut if meC-G (NEB); cuts if other C's are 5me-C (BRL); cuts if 1st two C are 4me-C (Ph) or internal 5me-C (Ph).
Other Buffer Components:
(1): 50 mM KCl.
(2): 33 mM tris-acetate (7.9), 10 mM Mg-acetate, 66 mM K-acetate, pH at 37°C, 0.1% BSA.
(3): 50 mM K-acetate; 20 mM tris-acetate pH 7.9; 10 mM Mg-acetate.
(4): 20 mM KCl.
(5): 33 mM tris-acetate, pH 7.9; 10 mM magnesium acetate; 66 mM potassium acetate; 0.01% BSA.


Sml I
C'TPyPuAG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest Temp: 55°C (NEB).
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM Tris-acetate (7.9); 10 mM Mg-acetate, 0.1% BSA.


SnaB I
TAC'GTA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(-) -- ------- -- - (3)
NEB(4) -- ------- -- 1 (2)
Pro(B) 50 6(7.5) 6 1  
Roche(M) 100 50(7.5) 10 - (1)
< B>Tak(Basal) -- ------- -- - (4)
Digest Temp: 37°C (Amer, NEB, Pro, Roche).
Isoschizomers: BstSN I, Eco105 I.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 80°C 20 min (NEB); not inactivated 65°C, 20 min (Pro, Roche).
Notes: 50% activity in PCR buffer (Roche). Activity determined on T7 DNA (Pro). Star activity: use more enzyme & less than 3 hrs digest (NEB). Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if meC-G (NEB, Tak), or if both A's are N6-me-A (Tak).
Other Buffer Components:
(1): 1 mM DTE.
(2): 50 mM K-acetate, 20 mM Tris-acetate (7.9); 10 mM Mg-acetate, 0.1% BSA.
(3): SnaBI basal buffer; 0.1% BSA.
(4): SnaB I basal buffer.


Spe I
A'CTAGT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(4) -- 20(7.4) 5 - (2)
NEB(2) 50 10(7.9) 10 1 (3)
Ph(H) 100 50(7.5) 10 1  
Pro(B) 50 6(7.5) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C. 4-fold increased activity at 50°C (BRL).
Isoschizomers: AclN I.
Other Compatible Ends: Avr II, Bln I, Nhe I, Xba I, some Sty I sites.
Inactivation Temp: 60°C 15 min (Amer, Tak); 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB, Ph).
Notes: 4-fold increased activity at 50°C but inactivated at 65°C (BRL); inhibit ed by >50 mM KCl or NaCl. Need 20 hr for >90% digestion of oligonucleotides with 1 or 2 adjacent nt on each side; additional nt on each side reduce efficency to 50% digestion (NEB). Activity decreases after 1 hr digest (BRL). Activity determined on Ad-2 DNA (Pro). After digest, fill-in, and ligation, site can be cut with Alu I, Bfa I (NEB). 25-50% activity in Pro(H) buffer (Pro). No activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5' N6-me-A or 5me-C (Ph, Tak) .
Other Buffer Components:
(1): 1 mM DTE.
(2): 50 mM KCl.
(3): 0.1% BSA.


Sph I
GCATG'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(6) 50 50(7.4) 6 - (3)
NEB(2) 50 10(7.9) 10 1  
Ph(H) 100 50(7.5) 10 1  
Pro(K) -- 10(7.4 ) 10 1 (2)
Roche(M) 50 10(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Bbu I, Nla III, Pae I.
Other Compatible Ends: BspH I, Hsp92 I, Nla II, Nla III, Nsp I, Nsp7524 I, NspH I.
Inactivation T emp: 60°C, 15 min (Amer, Tak); 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB, Ph).
Notes: Cuts pBR322&5 once in Tc gene. Stable 18 mo (Roche). Ph: activity determined on HdIII digested lambda. Use 2 U/µg for plasmids (BRL). Inhibited by < 25 mM NaCl & >10% glycerol. Star activity in Pro(C) buffer (Pro). Not active after 1 hour digest. Hard to phenol extract, aggregates with DNA. Low [NaCl] enhances aggregation. Need 20 hr and at least 4 bases on each side of oligonu cleotides for 50% digestion efficiency (NEB). <5% activity in PCR buffer (Roche). 100% activity in Pro(H) buffer (Pro). Not active after ethanol precipitation (Tak).
Methylation Effects: Cuts if 3' 5me-C (BRL, Ph, Tak), if both C's are hemi-methylated (Tak), if meC-G ovelaps site (NEB); not cut if N6-me-A (Ph, Tak).
Other Buffer Components:
(1): pH at 37°C, 1 mM DTE.
(2): 150 mM KCl.
(3): 50 mM KCl.


Spl I
C'GTACG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1 (1)
Digest Temp: 55°C (Amer).
Isoschizomers: BsiW I, Pfl23 II, PspL I, Sun I.
Inactivation Temp: Not heat inactivated, phenol extract (Amer).
Notes: Removed from 2000 Amer catalog.
Methylation Effects: Unknown.
Other Buffer Components:
(1): 0.1% BSA.


Sse8387 I
CCTGCA'GG
< !-- Table 268 Row 02 -->
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1 (1)
Tak(M) 50 10(7.5) 10 1 (2)
Digest Temp: 37°C.
Isoschizomers: Sbf I.
Inactivation Temp: 60°C, 15 min (Amer, Tak).
Notes: Only 60% active in Tak(M) buffer. Star activity in presence of DMSO (Tak) or in low ionic strength (Tak). No acti vity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5' C is 5me-C (Tak); cuts if both 1st & a C after the recognition site is 5me-C (Tak).
Other Buffer Components:
(1): 0.1% BSA.
(2): 0.01% BSA.


Ssp I
AAT'ATT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (3)
BRL(6) 50 50(7.4) 6 - (2)
NEB(-) 50 100(7.5) 10 - (4)
Ph(M) 50 10( 7.5) 10 1 (5)
Pro(E) 100 6(7.5) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(Basal) -- ------- -- - (4)
Digest Temp: 37°C.
Isoschizomers: Non e.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C 15 min (Amer, Tak), 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB, Ph).
Notes: Star activity (NEB) or inhibition (BRL) with >5% glycerol, star activity with high [glycerol] (Tak), with >50 mM NaCl (BRL), star activity with low ionic strength (NEB, Tak), high [enzyme], pH >8.0 (NEB), high pH (tak), or DMSO (Tak). Use 4U/µg for plasmids (BRL). Active after 5 hrs (BRL). Not active in PCR b uffer (Roche). Not active after ethanol precipitation (Tak). 100% activity in Pro(H) buffer (Pro).
Methylation Effects: Not afected by dam (Ph, Tak) or dcm methylation (Ph).
Other Buffer Components:
(1): 1 mM DTE.
(2): 50 mM KCl.
(3): 100 mM KCl; '96 catalog lists as SspI basal buffer.
(4): 0.025% triton-X 100.
(5): Deleted fro 1997 catalog.
(6): Ssp I basal buffer.


Ssp BI
T'GTACA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other Roche(B) 100 10(8.0) 5 - (1) Digest Temp: 50°C.
Isoschizomers: Bsp1407 I, BsrG I.
Inactivation Temp: 65°C, 15 min (Roche).
Methylati on Effects: Unknown
Other Buffer Components:
(1): 1 mM 2-me.


Sst I
GAGCT'C
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(2) 50 50(8.0) 10 -  
Digest Temp: 37°C.
Isoschizomers: Sac I, Ecl136 II (different cut site), EcoICR I (different cut site), Psp124B I.
Inactivation Temp: 65°C, 10 min (BRL).
Notes: Subset of Alu I sites. Star activity with >5% glycerol (BRL). <10% active at 100 mM NaCl (Pro). Active after 5 hour digest (BRL). >5% glycerol alters specificity (BRL). Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biot echn. 15:630, 1993).
Methylation Effects: Not cut if 5' 5me-C (BRL).


Sst II
CCGC'GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(2) 50 50(8.0) 10 -  
Digest Temp: 37°C.
Isoschizomers: Cfr42 I, Sac II, Ksp I, Sfr303 I.
Inactivation Temp: Not inactivated by 10 min at 65°C (BRL).
Notes: Star activity with >5% glycerol (BRL). Active after 5 hour digest (BRL). Rare cutter. Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993).
Methylation Effects: No cuts if me-C.


S tu I
AGG'CCT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
BRL(2) 50 50(8.0) 10 - & nbsp;
NEB(2) 50 10(7.9) 10 1  
Ph(M) 50 10(7.5) 10 1  
Pro(B) 50 6(7.5) 6 1  
Roche(B) 100 10(8.0)< /TD> 5 - (1)
Tak(M) 50 10(7.5) 10 1  
Digest Temp: 37°C.
Isoschizomers: Aat I, Eco147 I, Pme55 I, SseB I.
Other Compatible Ends: Blunt.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 10 min (BRL), 15 min (Pro), 20 min (NEB); 85°C, 30 min (Ph).
Notes: Active over 5 hrs. Don't use React 1 or 4 buff ers (BRL). Cuts in PCR buffer (Pro). 50% decreased activity with 100 mM NaCl (BRL). Only 30% activity in PCR buffer (Roche). About 65% (BRL), 90% (Pro) of these fragments can be religated. Add 1 nt to each side of a Stu I-containing oligonucleotide for &90% digestion efficiency after 2 hrs (NEB). Residual activity after ethanol precipitation (Tak).
Methylation Effects: Not cut if any 5me-C (NEB, Ph, Pro, BRL, Tak) or 3' 4me-C (Ph, Tak). dcm methylation recognition site = CC(A/T)GG.
Other Buffer Components:
(1): 2 mM 2-me.


Sty I
C'C(A/T)(A/T)GG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(3) 100 50(8.0) 10 -  
NEB(3) 100 50(7.9) 10 1 (2)
Pro(F) 100 10(8.5) 10 1  
Roche(H) 100 50(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: BssT1 I, Eco130 I, EcoT14 I, Erh I, TthB8 I.
Other Compatible Ends:
Inactivation Temp: 65°C, 10 min (BRL, Amer), 15 min (Pro), 20 min (NEB).
Notes: Use 8 U/µg plasmids (BRL). Not active after 1 hr. Don't use React 2 (BRL). 50-75% activity in Pro(H) buffer (Pro). Activity inhibited by >5% glycerol (BRL). <5% activity in PCR buffer, but this was restored to 100% by with 100 mM NaCl (Roche). About 2/3 of these fragments can be religated in 1 hr. (BRL).
Methylation Effects: Unknown
Oth er Buffer Components:
(1): 1 mM DTE.
(2): 0.1% BSA.


Sun I
C'GTACG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(4) -- 20(7.4) 5 - (1)
Digest temp: 55°C.
Isoschizomers: BsiW I, Pfl23 I, PspL I, Spl I.
Inactivation Temp: Not inactivated at 65°C, 10 min (BRL).
Notes: Activity decreased after 2 hrs (BRL).
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM KCl.


Swa I
ATTT'AAAT.
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 (2)
Roche(H) 100 50(7.5) 10 -- (1)
Digest Temp: 25°C (Roche, NEB).
Isoschizomers: Smi I.
Inactivation Temp: 65°C, 20 min (NEB); not ina ctivated at 65°C, 15 min (Roche).
Notes: About 75% of Swa I fragments can be relegated (NEB).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE.
(2): 0.1% BSA.


Tai I
ACGT'
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(R) -- 10(8.5) 10 - (1)
Digest Temp: 65°C (NEB). <10 activity at 37° (NEB).
Isoschizomers: HpyCH4 IV, Mae II.
Inactivation Temp: Not inactivated at 65°C, 20 min (NEB).
Notes: Not in NEB 1998/99 catalog.
Methylation Effects: No cuts if meC-G (NEB).
Other Buffer Components:
(1): 100 mM K Cl, 0.1% BSA.


Taq I
T'CGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(T) -- ------- -- 0.5 (1)
BRL(2) 50 50(8.0) 10 -  
NEB(-) 100 100(8.4) 10 - (3)
Ph(M) 50 10(7.5) 10 1  
Pro(E) 100 6(7.5) 6 1  
Roche(B) 100 10(8.0) 10 - (2)
Digest Temp: 65°C (all sources). 10% (NEB, Pro) activity at 37°C.
Isoschizomers: TthHB8 I.
Other Compatible Ends: Aci I, Acy I, Aha II, Asu II, Ban III, Bbi II, BsaH I, BsiC I, BsiX I, Bsp106 I, BspD I, BstB I, Cla I, Csp45 I, Fnu4H I, Hap II, HgiD I, Hin1 I, HinP I, HinP1 I, Hpa II, Hsp92 I, Mae II, Mlu I, Msp I, Nar I, Nsp V, Nsp7524 V, Nun II, Psp1406 I, Sfu I; some Acc I sites.
Inactivation Temp: 80°C 20 min (NEB); 85°C 30 min (Ph); not inactivated 65°C, 10 min (BRL), 15 min (Roche), 20 min (Amer).
Notes: Active up to 70°C. (pH Tris at 25°C). Clonable in Cla I site of pBR322 (not selectable). Sensitive to DNA contaminants. Stable 18 mo (Roche). Cuts ssDNA (slowly NEB) & perhaps RNA of DNA/RNA hybrids at correct site. Use 10 - 15 U/µg for plasmids (2 for BRL). Activity decreases after 3 hr digest (BRL). <10% activity at 150 mM NaCl (Pro). Active for more than 5 hrs (BRL). Methylase available. 100% active in PCR buffer (Roche). Cuts in PCR buffer (Pro). 50% activity without 100µg/ml acetylated BSA (NEB). After digest, fill-in, and ligation, site can be cut with BstU I, Nru I (NEB).
Methylation Effects: No cuts of N6-me-A (Ph, NEB, BRL, Pro); OK if 5me-C (BRL, Ph), h5me-C (Ph), or if meC-G overlaps the site (NEB).
Other Buffer Components:
(1): 33 mM tris-acetate (7.9),10 mM Mg-acetate, 66 mM K-acetate.
(2): 1 mM 2-ME.
(3): 0.1% BSA.


Tfi I
G'A(A/T)TC
< TD> 
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1
Digest Temp: 65°C (NEB). 10% activity at 37°C (Amer, NEB).
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes: Star activity: low ionic strength, high (>20U/µg) [enzyme], >5% glycerol, pH >8.0 (NEB).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB).


Tha I
CG'CG
BRL(1) -- 50(8.0) 10 -  
Digest Temp: 60°C.
Isoschizomers: Acc II, Bsh1236 I, Bsp50 I, BstU I, Mvn I.
Other Compatible Ends: Blunt.
Inactivation Temp: Not inactivated 10 m in 65°C (BRL).
Notes: Use 2 U/µg for plasmids (BRL). <10% activity at 100 mM NaCl (Pro). Not active after 2 hr digest (BRL). Don't use React 4 (BRL). More than 65% of these fragments can be religated (BRL).
Methylation Effects: No cuts if either C is 5me-C (BRL).


Tli I
C'TCGAG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1 (1)
Digest Temp: 75°C.
Isoschizomers: Xho I.
Inactivation Temp: Not heat inactivated (NEB).
Methylation Effects: Unknown
Notes: Less than 10% activity at 37°C (NEB). Keep digestions to less than 2 hours (NEB).
Other Buffer Components:
(1): 100 µg/ml BSA.


Tru9 I
T'TAA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(F) 100 10(8.5) 10 1  
Roche(M) 50 10(7.5) 10 -- (1)
Digest Temp: 65°C. <10% activity at 37°C (Pro).
Isoschizomers: Mse I, Tru1 I.
Other Compatible Ends: Ase I, Asn I, Mae I, Mse I, Nde I, Vsp I.
Inactivation Temp: Not inactivated at 65°C 15 min (Roche, Pro).
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE.


Tse I
G'C(A/T)GC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(3) 100 50(7.9) 10 1  
Digest Temp: 65°C (NEB). 10% activity at 37°C (NEB).
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Methylation Effects: Unknown


Tsp45 I
'GT(G/C)AC
< TD>--
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(1) -- ------- 1 (1)
Digest Temp: 65°C (NEB). 10% activity at 37° (NEB).
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes:
Methylation Effects: Unknown
Other Buffer Components:
(1): 10 mM bis tris-propane-HCl(7.0), 10 mM MgCl2, 0.1% BSA.


Tsp509 I
'AATT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(1) -- -- -- 1 (1)
Digest Temp: 65°C (NEB). 10% active at 37°C (NEB).
Isoschizomers: Sse9 I, TspE I.
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes: <10% activity at 37° (NEB). After digest, fill-in, and ligation, site can be cut with Ase I, Mse I, Tsp509 I (NEB).
Methylation Effects: Sensitive to EcoR I methylase (NEB).
Other Buffer Components:
(1): 10 mM bis tris-propane-HCl(7.0), 10 mM MgCl2.


TspR I
NNCA(C/G)TGNN'
Source [NaCl] [Tris](pH) < B>[Mg++] [DTT] Other
NEB(4) -- ------- -- 1 (1)
Digest temp: 65°C (NEB). 10% active at 37°C (NEB).
Inactivation Temp: Not inactivated 65°C, 20 min (NEB).
Notes:9bp 3' extension.
Methylation Effects: Unknown
Other Buffer Components:
(1): 10 mM bis tris-propane -HCl(7.0), 10 mM MgCl2, 0.1% BSA.


Tth111 I
GACN'NNGTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(K) -- 20(8.5) 10 1 (2)
NEB(1) -- ------- 10 1 (1)
Pro(B) 50 6(7.5) 6 1  
Tak(K) -- 20(8.5) 10 1 (2)
Digest Temp: 65°C (Amer, NEB, Pro). 10% activity at 37°C (Amer, NEB, Pro).
Isoschizomers: Asp I (37°C digest), Ats I.
Other Compatible Ends:
Inactivation Temp: Not inactivated 65°C, 15 min (Pro), 20 min (NEB, Ph), 70°C 15 min (Tak); use ethanol precipitation (Amer, Tak).
Notes: Moderately BAP resistant. Star activity: different cutting buffer (Ph); low ionic strength (NEB), high [enzyme] (NEB) >5U/µg enz:DNA (Pro), [glycerol] >5% (NEB), pH>8.0 (NEB), Mn ions (Tak), high pH (Tak), or high salt (Tak). Star activity sites: NACN/NNGTC, GACN/NNNTC, or GACN/NNGNC. PflF I seems to lack star activity problems (NEB). Few sites so get large fragments with eukaryotic DNA. Activity determined on Ad-2 DNA (Pro). Not active after ethanol precipitation (Tak). <10% (NEB) of these fragments can be religated; ligation difficult (Pro).
Methylation Effects: Cuts if meC-G overlaps RE site (NEB, Tak).
Other Buffer Components:
(1): 10 mM Tris Propane-HCl.
(2): 100 mM KCl.


TthHB8 I
T'CGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
Tak(H) 100 50(7.5) 10 1  
Digest temp: 65°C.
Isoschizomers: Taq I.
I nactivation Temp: Not inactivated, phenol extract (Amer, Tak).
Notes: Star activity with high pH (Tak), low ionic strength (Tak), or DMSO (Tak). Residual activity after ethanol precipitation (Tak).
Methylation Effects: Cuts if 5me-C (Tak); no cuts if N6-me-A (Tak).


Van91 I
CCAN(4)'NTGG
Source [NaCl] [Tris](pH) [M g++] [DTT] Other
Roche(B) 100 10(8.0) 5 - (1)
Tak(K) -- 20(8.5) 10 1 (2)
Digest Temp: 37°C.
Isoschizomers: AccB7 I, Esp1396 I, PflM I.
Inactivation Temp: 60°C 15 min (Tak), 65°C, 15 min (Roche).
Notes: Star activity with high [gly cerol] (Tak). Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 2nd C is 5me-C (Tak).
Other Buffer Components:
(1): 1 mM 2-me.
(2): 100 mM KCl.


Vsp I
AT'TAAT
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(2) 50 50(8.0) 10 -  
Pro(D) 150 6(7.9) 6 1  
Digest Temp: 37°C.
Isoschizomers: Ase I, Asn I, PshB I.
Other Compatible Ends: Mae I, Mse I, Nde I, Tru9 I.
Inactivation Temp: 65°C, 15 min (Pro); not inactivated at 65 76;C, 10 min (BRL).
Notes: Activity decreases after 4 hr digest (BRL). About 70% of these fragments can be religated (Pro).
Methylation Effects: Unknown


Xba I
T'CTAGA
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1 (2)
BRL(2) 50 50(8.0) 10 -  
NEB(2) 50 10(7.9) 10 1 (2)
Ph(M) 50 10(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(M) 50 10(7.5) 10 1 (3)
Digest Temp: 37°C.
Isoschizomers: None.
Other Compatible Ends: Avr II, Bln I, Nhe I, Spe I, som e Sty I sites.
Inactivation Temp: 60°C, 15 min (Amer, Tak); 65°C, 15 min (Pro), 20 min (NEB, Ph); not inactivated 65°C, 10 min (BRL).
Notes: Possible star activity with different buffers, high [enzyme], >5% glycerol (BRL), low [salt] (BRL); star activity if ethylene glycol or DMSO (NEB). Star activity sequences: N/CTAGN or N/CTANN. Stable 18 mo. (Roche). Activity determined on EcoR I cut lambda (Ph), unmethylated Bgl II lambda (Pro). Optimal activity at 100 mM NaCl. Only 80% active in Tak(M) buffer. Activity varies with substrate. Need at least 2 bases on each side of an oligonucleotide for >90% digestion in 2 hrs (NEB). 60% activity in PCR buffer (Roche). 100% activity in Pro(H) buffer (Pro). Active up to 5 hrs, decreased activity after 2 hrs (BRL). Cuts in PCR buffer (Pro). After digest, fill-in, and ligation, site can be cut with Alu I, Bfa I (NEB). At least 65% of these fragments can be religated overnight (BRL). Residual activity after ethanol precipitation (Tak).
Methylation Effects: No cuts if 5me-C (BRL,Ph, Tak), hme-5-C (Ph), or 3' N6-me-A (BRL, Ph, Tak); blocked by dam methylation (NEB, Pro).
Other Buffer Components:
(1): 1 mM DTE.
(2): 0.1% BSA.
(3): 0.01% BSA.


Xcm I
CCANNNNN'NNNNTGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(M) 50 10(7.5) 10 1  
NEB(2) 50 10(7.9) 10 1  
Digest Temp: 37°C.
Inactivation Temp: 65°C, 20 min (NEB, Amer).
Notes: About 20-25% of these fragments can be religated (Amer, NEB). Removed from 2000 Amer catalog.
Methylation Effects: Un known


Xho I
C'TCGAG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Amer(H) 100 50(7.5) 10 1  
BRL(2) 50 50(8.0) 10 -  
NEB( 2) 50 10(7.9) 10 1 (2)
Ph(H) 100 50(7.5) 10 1  
Pro(D) 150 6(7.9) 6 1  
Roche(H) 100 50(7.5) 10 - (1)
Tak(H) 100 50(7.5) 10 1 &n bsp;
Digest Temp: 37°C.
Isoschizomers: Ccr I, PaeR7 I, Sfr274 I, Tli I.
Other Compatible Ends: Sal I, ApaLI; some Ava I sites.
Inactivation Temp: 65°C, 15 min (Pro), 20 min (Ph, NEB); not inactivated 65°C 10 min (BRL), 15 min (Roche), not inactivated use ethanol precipitation (Amer, Tak).
Notes: Sensitive to DNA contaminants. Unstable, use within 3 mo (IBI), 18 mo (Roche). We have had NEB enzyme s till active after 3 yrs. Activity assayed on EcoR I cut lambda (Ph, Pro). For optimal cloning & labeling: 100 µg/ml proteinase K, 30 min, 37°C. <10% activity without NaCl (Pro). Active after 5 hour digest (BRL). Needs 20hr digest for 75% cutting of oligonucleotides with 3 bases on each side (NEB). Not inhibited by up to 100-fold excess of ssDNA PCR primer containing the recognition sequence (Biotechn. 15:630, 1993). <5% activity in PCR buffer (Roche). 100% activity in Pro(H) buffer (P ro). After digest, fill-in, and ligation, site can be cut with BstE I, Mbo I, Pvu I, Taq I (NEB).
Methylation Effects: No cuts if 5' (Tak) or any 5me-C(BRL, Ph, NEB), or N6-me-A (BRL, Ph); cuts if 3' 5me-C (Tak).
Other Buffer Components:
(1): 1 mM DTE.
(2): 0.1% BSA.


Xho II
Pu'GATCPy
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Pro(C) 50 10(7.9) 10 1  
Roche(L) -- 10(7.5) 10 -  
Digest Temp: 37°C.
Isoschizomers: BstX2 I, BstY I, Mfl I.
Other Compatible Ends: BamH I, BanH I, Bcl I, Bgl II, Mbo I, Nde II, Sau3A I.
Inactivation Temp: 65°C, 15 min (Pro).
Notes: Stable 18 mo (Roche). After BamH I to Bgl II ligations, site can't be cleaved with Bam or Bgl, but it can with Xho II. Activity determined on pBR322 DNA (Pro).
Methylation Effects: Not blocked by dam methylation (Pro).


Xma I
C'CCGGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] < B>Other
Amer(L) -- 10(7.5) 10 1  
NEB(4) -- ------- -- 1 (1)
Ph(L) -- 10(7.5) 10 1  
Pro(B) 50 6(7.5) 6 1  
Digest Temp: 30°C (Ph); 37 6;C (Amer, NEB, Pro).
Isoschizomers: Cfr9 I, PspA I, PspAL I (different cut site), Sma I (different cut site), Eag I, Xcy I, XmaC I.
Other Compatible Ends: Acc III, Age I, Bca77 I, BsaW I, BseA I, BsiM I, BspE I, BsrF I, Bsu23 I, Cfr9 I, Cfr10 I, Kpn2 I, Mro I, NgoA IV, NgoM I, PinA I, SgrA I.
Inactivation Temp: Partially resistant 65°C (BRL); inactivated 65°C 15 min (Pro), 20 min (NEB, Ph, Amer).
Notes: Somewhat resistant to DNA contaminants. Activity assayed on HdIII lambda (Ph), Ad-2 DNA (Pro). Digest plasmids overnight with 0.5 - 1.0 U/µg (NEB, Ph). Add 100µg BSA/ml for digests > 2 hrs (NEB, Ph). Use 8 U/µg for plasmids; or 0.5-1 U/µg with overnight digestion with BSA. Neighboring sequences affect activity. <10% active at 100 mM NaCl (Pro). Half-life 37°C is 16 hrs, -20°C is 2 yrs (NEB). Cuts in PCR buffer (Pro). <10% activity in Pro(H) buffer (Pro). After digest, fill-in, and ligation, site can be c ut with BsiE I, Eae I, Eag I, Hae III, Hpa II, Nci I, ScrF I (NEB). Two hour digestion of oligonucleotides with 2, 3, or 4 adjacent nt on each side results in 25%, 50%, and >90% digestion efficiency; or 75%, >90%, and >90% over a 20 hour period, respectively (NEB).
Methylation Effects: No cuts if any 4me-C or 5' 5me-C (Ph); 3' 5me-C is cut (Ph) as is meC-G if it overlaps RE site (NEB).
Other Buffer Components:
(1): 50 mM K-acetate, 20 mM Tris-acetate (7.9), 10 mM Mg- acetate, 0.1% BSA.


Xma III
C'GGCCG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(5) -- 10(8.2) 8 -  
Digest Temp: 25°C (BRL).
Isoschizomers: BstZ I, Ccr I, Eag I, EclX I, Eco52 I, PaeR7 I.
Inactivation Temp: Partially inactivated at 65°C, 10 min (BRL).
Notes: Some sites may need 1000-fold excess enzyme to be cut. 3-6 month stability (IBI). <10% activity at 150 mM NaCl (Pro). Active after 5 hour digest (BRL). Use >8 U/µg for supercoiled plasmids (BRL).
Methylation Effects: No cuts if middle C is 5me-C (BRL).


XmaC I
C'CCGGG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
Roche(L) -- 10(7.5) 10 - (1)
Digest Temp: 37°C.
Isoschizomers: Cfr9 I, PspA I, PspAL I (different cut site), Sma I (different cut site), Xma I.
Methylation Effects: Unknown
Other Buffer Components:
(1): 1 mM DTE.


Xmn I
GAANN'NNTTC
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
NEB(2) 50 10(7.9) 10 1 (1)
Pro(B) 50 6(7.5) 6 1  
Digest Temp: 37°C (NEB).
Isoschizomers: Asp700 I.
Other Compatible Ends: Blunt.
Inactivation Temp: 65°C, 20 min (NEB).
Notes: EcoR I sites filled in by DNA Pol & blunt ligated = Xmn I sites. Low ionic strength (NEB), high [enzyme] (NEB) (>25U/µg of DNA Pro), [glycerol] >5% (NEB, Pro), or pH >8.0 (NEB) give star activity. About 80% of XmnI fragments can be religated (Pro).
Methylation Effects: Not sensitive to m5-CG or m5-CNG. Other Buffer Components:
(1): 0.1% BSA.


Xor II
CGAT'CG
Source [NaCl] [Tris](pH) [Mg++] [DTT] Other
BRL(4) -- 20(7.4) 5 - (1)
Digest Temp: 37°C.
Isoschizomers: PvuI & RshI.
Inactivation Temp: Not inactivated 10 min at 65°C (BRL).
Notes: Doesn't cut me-DNA well. 25-fold excess enzyme, 24 hr to cut pBR322. Use 8 U/µg for supercoiled & linear plasmids. Activity decreases after 1 hr digest (BRL). Removed from 1997-8 BRL catalog.
Methylation Effects: Unknown
Other Buffer Components:
(1): 50 mM KCl.


Last revised July 2000 by M. B. Frank, Ph.D.
Copyright 1997, 1998, 1999, 2000 by Mark Barton Frank, Ph.D.